1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ratling [72]
3 years ago
15

Neuronal communication is a two step process. In the second step, which takes place between two neurons, what does the arrival o

f an action potential at the axon terminal of the first neuron signal
Biology
1 answer:
Oksi-84 [34.3K]3 years ago
8 0
When an action potential does arrive at the terminal, the neurotransmitter must be quickly and efficiently released from the terminal<span> and into the synaptic cleft. The neurotransmitter must then be recognized by </span>selective receptors on the postsynaptic cell<span> so that it can pass along the signal and initiate another action potential.</span>
You might be interested in
Need somebody to help!!!!
Alex777 [14]

Answer:

I would say the first option

Explanation:

8 0
2 years ago
Read 2 more answers
Please help with d and explain
Nadya [2.5K]
The answer would be AB+40.
8 0
3 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
The calorie used on food labels is equal to
kvasek [131]
A calorie is a unit of.
Energy.
The Calorie used on food labels is equal to.
1000 calories<span>.</span>
4 0
3 years ago
What two gases together make up 99% of Earth's atmosphere?
Soloha48 [4]
The two gasses that make up 99% of the earth's atmosphere are nitrogen and oxygen. 
Hope that helped! =)
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which molecule is the largest ?<br> A. sucrose<br> B. glucose<br> C. heme<br> D. CO2
    9·1 answer
  • List the reasons why food chains to not send to exceed 4 links
    15·1 answer
  • Which statement correctly describes a characteristic that a scientific
    14·2 answers
  • If the ribosomes of a cell were destroyed, what effect would this most likely have on the cell?
    12·1 answer
  • Macrophage cells undergo a process called phagocytosis in which material is brought into a cell in the form of membrane vesicles
    7·1 answer
  • Which of the following produces carbon dioxide?
    15·1 answer
  • Pacemakers maintain the heartbeat in people who suffer from certain defects. The function of an artificial pacemaker is to send
    11·2 answers
  • Identifying Benefits of Social Behavior
    9·1 answer
  • Wyjaśnij jakie znaczenie ma fakt, że smak gorzki jest wykrywany już przy bardzo niewielkich ilościach substancji.
    7·1 answer
  • Which of these is evidence of global warming?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!