1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tiny-mole [99]
3 years ago
5

An organism which eats both vegetables (plants) and other animals

Biology
1 answer:
kkurt [141]3 years ago
7 0

an organism that eats both plants and animals is an omnivore

You might be interested in
Which component cannot be part of this strand?
Irina18 [472]
A- uracil, test prep question
4 0
3 years ago
Read 2 more answers
A human’s knee joint is best described as
vesna_86 [32]

Answer:

A synovial joint

Explanation:

because it is highly moveable, allows for flexibility, has ligaments for stability, and has cartilage for protection of the articulating bones. ... It is a synarthrosis joint because it cannot move.

4 0
2 years ago
Read 2 more answers
At which temperature a chocolate can melt in the sun
geniusboy [140]

Always melt chocolate slowly, at a low temperature. The melting point of chocolate is between 86 degrees F. (30 degrees C.) and 90 degrees F.

6 0
2 years ago
Read 2 more answers
What makes female bees unique?
MrRissso [65]

Answer:

the correct answer is b

4 0
3 years ago
Read 2 more answers
What would happen over the following fifty years if a fire burned off all of the vegetation in the area
Bezzdna [24]
People would have to plant more, people could die, animals could die.
5 0
3 years ago
Other questions:
  • Which organ helps to process essential proteins and minerals, so that they can then be taken through the bloodstream and to the
    11·2 answers
  • Approximately how many female offspring are produced by 3-4 year old female ground squirrels? approximately how many female offs
    6·2 answers
  • Help me please!!!!!<br><br> 20 POINTS!!!! Plus brainliest!!!<br><br> Thanks in advance!!
    9·1 answer
  • Starting billions of years ago, in what way did algae change the atmosphere of
    8·2 answers
  • Dna is composed of repeating structural units called?
    9·2 answers
  • Which level of ecological organization is referenced in this statement: In the clear water around the coral reef, clownfish coul
    10·1 answer
  • Which statement is true of enzymes? Choose 1 answer: (Choice A, Checked)
    14·1 answer
  • Please explain to me the mechanism of hearing...
    14·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • The San Marcos salamander, Eurycea nana, is a light reddish-brown translucent salamander about 2-5 cm in length. E. Nanais found
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!