1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dybincka [34]
3 years ago
9

What controls the passage of chyme from the last region of the stomach to the duodenum region of the small intestine?

Biology
1 answer:
givi [52]3 years ago
6 0

Answer:

The chyme is pushed along the small intestine by muscle contractions called peristaltic waves. Most of the chemical digestion and breakdown of the food happens in the duodenum. Food is mixed with bile from the gallbladder and digestive juices from the pancreas.

Explanation:

Chyme, a thick semifluid mass of partially digested food and digestive secretions that is formed in the stomach and intestine during digestion. In the stomach, digestive juices are formed by the gastric glands; these secretions include the enzyme pepsin, which breaks down proteins, and hydrochloric acid.

The stomach has four major regions: the cardia, fundus, body, and pylorus. The addition of an inner oblique smooth muscle layer gives the muscularis the ability to vigorously churn and mix food.

You might be interested in
The supply chain function works with marketing and engineering to identify and qualify suppliers of goods and services as well a
borishaifa [10]

Answer:

D. purchasing

Explanation:

The purchasing function in the supply chain <em>manages everything related to the inputs of a firm, this means it deal with purchased goods, materials, and services.</em>

I hope you find this information useful and interesting! Good luck!

3 0
3 years ago
Will fluorite scratch penny why or why not
Gekata [30.6K]
Fluorite can scratch a copper coin but cannot be scratched by a copper coin. This is because according to Mohs scale of hardness, fluorite has a hardness of four. Copper has a hardness of three. Therefore fluorite is a harder mineral than copper and will scratch copper but it will not be scratched by copper. Mohs based his scale on the fact that some minerals could scratch others. If one mineral could scratch another but could not be scratched by it, he reasoned that it must be harder.
7 0
3 years ago
Read 2 more answers
In a study of genetic variation of the Graceland gene, a researcher finds that there are two alleles in a population. In a large
Fed [463]

Answer:

grrrrrrrrrrrrrrrrrrrrrr

Explanation:

shart

5 0
3 years ago
How do bodies of water shape our land formations (mountains island continents
kondor19780726 [428]

A landform is a natural feature of the solid surface of the Earth or other planetary body. Landforms together make up a given terrain, and their arrangement in the landscape is known as topography. Typical landforms include hills, mountains, plateaus, canyons, and valleys, ... Oceans and continents exemplify the highest-order landforms.


5 0
3 years ago
Tanner is convinced that the circulatory system and the immune system do not function together in humans. He did complete
Lilit [14]

Answer:

D

Explanation:

All the body's systems are linked together in some way. They all interact to produce a fully functioning organism.

A is not correct, becomes hormones are part of the endocrine system, not the immyne system.

B is not correct, because they are not explicitly involved in homeostasis

C is incorrect, all the systems are always working in the background.

The correct answer is D, one way in which the two systems are linked is that the cells of the immune system need to circulate around the body. The circulatory system is incredibly important for this, ensuring that the cells can reach their target sites

4 0
3 years ago
Other questions:
  • A group of environmental scientists wants to study the impact of population growth on the environment. Which discipline will con
    15·2 answers
  • What are the major differences between meiosis and mitosis in terms of outcome and events?
    5·1 answer
  • 21. Cells of the immune system are able to respond to the presence of
    11·1 answer
  • What is true about an atom
    7·2 answers
  • What 3 mineral resources can be harvested from the ocean ? pick three.
    12·2 answers
  • The kidneys are connected to the heart by the___ arteries. A. Retina B. Cilia C. Capillary D. Renal
    10·1 answer
  • Vitamin C
    8·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Sedimentary rocks are commonly made of ____ that are compacted and cemented together
    10·1 answer
  • How many seconds would it take DNA polymerase to replicate one set of human chromosomes (6,000,000,000 bytes long)
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!