1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleks04 [339]
2 years ago
14

The carbon cycle is closely linked to which of the following processes?

Biology
1 answer:
Alik [6]2 years ago
8 0
I think it undergo precipitation process
You might be interested in
5.You are doing an experiment involving the gain in mass of rats given different amounts of
dybincka [34]

Answer:

The independent variable are the vitamins .

The dependent variable are the rats.

Explanation:

The vitamins are the independent variable because they are are controllable. You can control how many vitamins the rats will be given.

8 0
3 years ago
Who selected the individuals that would reproduce to pass along their traits?
antiseptic1488 [7]

Answer:

Gregor Mendel

Explanation:

He was the first to describe how characteristics are passed down from generation to generation.

4 0
2 years ago
Read 2 more answers
What virus can infects only cats
anastassius [24]

Answer:

Feline Immunodeficiency Virus

Explanation:

8 0
3 years ago
A plant ‘X' has needle-like waxy leaves,plant ‘Y' has spiny leaves and a well developed root system,whereas, plant ‘Z' has ribbo
tensa zangetsu [6.8K]

Habitats of the plants:

X : winter or cold mountainous habitat

Y : desert habitat

Z:  Aquatic habitat

Explanation:

The X plant leave morphology suggests that thick wax coating of leaf helps it to retain water in it. Such plants are called conifers. They are not shed every year so suitable for sunlight to be captured for photosynthesis. In cold regions heavy wind happens cone like leaf is able to resist the winds and prevent it from falling. The cone like structure of leaves help them let the snowfall.

The plant Y leaves and root morphology suggests that it is well suited for dry lands or desert as where less water is there. They store water for longer time when it rains because of the extensive root system. The spine leaves help in reduced transpiration as water scarcity is there.

The plant Z leaves morphology suggests that thin and ribbon structure leaves can help them resist the pressures of flowing water as there are air space in the leaves which provide buoyancy to the leaves.  

8 0
3 years ago
Company's of the innate response include
andrey2020 [161]
I believe the answer is b
6 0
2 years ago
Other questions:
  • Explain how enzymes function as biological catalysts in chemical reactions.
    9·1 answer
  • Which are two of the aspects of family closeness during adolescence?
    9·1 answer
  • Wich cellular process takes place in the ribosomes that are bound to the endoplasmic reticulum? a.- the breakdown of waster mate
    8·2 answers
  • How the functions of organelles in animal cells and plant cells are different?
    11·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • If the atomic mass of fluorine is 19 with 9 protons, how many neutrons would it have?
    10·1 answer
  • An example of a solution is vinegar because it has 5% acid and 95% water. Question 7 options: True False
    13·1 answer
  • A The Atlantic Ocean will become wider
    13·1 answer
  • The nucleus is filled with a jellylike called the
    13·2 answers
  • 7. After grazing on grass, a rabbit is eaten by a snake. The snake also eats a mouse later that day. Which of the following stat
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!