1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
forsale [732]
3 years ago
5

What is the process of breaking down rock

Biology
1 answer:
Mekhanik [1.2K]3 years ago
4 0

Answer:

Weathering

Explanation:

Process where rock is dissolved, worn away or broken down into smaller pieces.

You might be interested in
Glucose provides energy for cells. Different cells have different mechanisms for glucose intake. Intestinal cells contain protei
Ahat [919]

active transport in small intestines and passive transport in blood cells

7 0
3 years ago
Read 2 more answers
A pizza had 12 slices, but now only 3 are left what fraction was eaten
oksano4ka [1.4K]

Answer:

9/12, 3/4

Explanation:

Have a good day!!

3 0
3 years ago
How did your family or parents affect your adolescent development? explain.
bazaltina [42]

Answer:

Explanation:

With a young, adolescent brain, you can easily be guided or persuaded to believe or do such things as the people around you. What the people around you do, good or not, it can affect you and make you believe from a young age that that is what you should be doing or believing in life. hope this helps

6 0
3 years ago
Read 2 more answers
Which characteristic is distinctive of hominids?
dexar [7]
Hominids are bipedal and have big brains. They have several skeletal adaptations to walking upright, such as curved vertebrae and angled femurs. Hominids became omnivores and developing cooking, which helped make their teeth and jaws smaller. The handy man, Homo habilis lived around 2.33 to 1.44 million years ago.Feb 25, 2015

Link: https://study.com/academy/lesson/hominids-traits-diet-behavior.html

Note: This information is taken out of a website.
7 0
3 years ago
Why does dna matter?
mrs_skeptik [129]
Because it codes for specific proteins and contains the genetic instructions needed in order for an organism to survive, develop and reproduce
8 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Ecology is the study of the interaction of living organisms: A with each other and their habitat B and their communities C with
    9·2 answers
  • Specifically how long did each eon last?
    9·1 answer
  • Which type of placentation is found in dogs and cats
    5·1 answer
  • During which period did the first land vertebrates appear?
    12·1 answer
  • Why is protein synthesis necessary for cell division to occur
    6·1 answer
  • Why Is It Important To Avoid Applying Too Much Nitrogen Fertilizer?
    11·2 answers
  • What is the significance of secondary growth in plants?
    6·2 answers
  • 17. Why is learning theory valuable for a dog trainer?
    10·1 answer
  • An animal cell lacking oligosaccharides on the external surface of its plasma membrane would likely be impaired in which functio
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!