1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreyandreev [35.5K]
3 years ago
7

What is meant by allele frequency?

Biology
2 answers:
myrzilka [38]3 years ago
7 0

Answer: Option A

Explanation:

Allele frequency can be defined as the measurement of relative frequency of allele on a genetic locus in a population.

It is expressed in the from of percentage or portion. It indicates the diversity of organism in the population.It can also be defined as the richness of the gene pool.

The changes in the environmental conditions can lead to the change in the  allele frequency.

LuckyWell [14K]3 years ago
6 0
Allele frequency of lillied in a given population so it should be A
You might be interested in
The table below shows part of the process of DNA replication:
svp [43]

Answer:

There will be a change in the genetic information that gets transmitted due to the mutation in the complementary strand being used as template in future DNA replication.

Explanation:

PLEASE MARK ME AS BRAINLIEST

3 0
3 years ago
Which layer of Earth has the lowest temperature, is entirely solid, and floats on top of fluid-like matter?
anyanavicka [17]
Crust maybe I'm not for sure.
6 0
3 years ago
Read 2 more answers
What other cells structures does mitochondria work with?
maksim [4K]
Other cells structures that mitochondria work with is : chloroplast

they work together in energy cycle and release ATP into the cell during respiration process

hope this helps

8 0
3 years ago
_____ is the study of how organisms interact with the living and nonliving parts of their environment.
Eduardwww [97]

Answer:

c. Ecosystem science

Explanation:

<em>Sustainability is incorrect because it means the existence of resources for a long term.</em>

<em>Environmental science is incorrect because it is the branch of science that studies the processes and interactions that affect the environment.</em>

<em>Biodiversity science is incorrect because it is the study of various species that  occupy a particular area.</em>

The correct option is c. Ecosystem science is the study of community of living organisms, how they interact with themselves and with non-living components of the community.

3 0
3 years ago
The main type of carbohydrates the food contains
marin [14]

Answer: your on the right track

Explanation:

Try again

5 0
3 years ago
Read 2 more answers
Other questions:
  • Barium metal has a body-centered cubic lattice with all atoms at lattice points; its density is 3.51 g/cm3. From these data and
    11·1 answer
  • A mutation creates a dominant negative allele of a particular gene. The normal allele of the gene encodes a protein that forms a
    11·1 answer
  • The role of pigments in the photosynthesis reaction is to
    10·2 answers
  • Which numbers identify the organelles that are present in BOTH plant and animal cells? A) 1, 2, 3, 4, 5 B) 1, 4, 5 C) 1, 5 D) 1,
    7·2 answers
  • Complete each sentence regarding the bones of the lower extremity. Then place the sentences in order, based on the bones, from p
    6·1 answer
  • if you had been older in 2017, would you have driven to Oregon to see the total solar eclipse? Explain your answer.​
    11·1 answer
  • Help pls'll give brainlest
    6·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Explain the water cycle in polar regions​
    8·1 answer
  • Calculate the genotypic and phenotypic ratios for the following crosses in peas for height, determined by the T gene. (T is Tall
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!