1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vladimir [108]
3 years ago
14

Which of the following statements is false? Select one: a. Estrogen causes endometrial cells to proliferate. b. After ovulation,

the endometrium becomes thicker. c. Rising progesterone levels cause the myometrium to contract. d. The uterine cycle makes the endometrium a hospitable environment for implantation. e. The endometrium receives the trophoblast.
Biology
1 answer:
ANTONII [103]3 years ago
6 0

A, B, C, D are correct and E is false

You might be interested in
What is the 2nd phase of cellular respiration? what happens?
liubo4ka [24]

The second phage of cellular respiration is transition stage.

Process take place in transition stage:

The transition stage take place in mitochondria. The pyruvate is combined with NAD+ to form NADH and acetyl co-enzyme molecules.

After transition stage, Krebs cycle starts.

5 0
3 years ago
Which of the following is a limitation of using a model to study a natural event?
Leto [7]

Answer:

C. The results of a model event may not be similar enough to the results of the actual event.

Explanation:

The problem with models is that sometimes we trust them too much! Sometimes they are not accurate for long-term actual events. This is answer choice C.

  • Models are never more accurate than reality, so rule out A.
  • The model is based on our predictions of the actual event, so rule out B.
  • The model being "too similar" to the actual event is what we want! So rule out D.
4 0
3 years ago
Read 2 more answers
Assume sexual reproduction occurs. What is the number of chromosomes in the zygote if the parent's reproductive cells or gametes
Rudik [331]
<span>If the parent's reproductive cells or gametes contain 12 chromosomes each, the number of chromosomes in the zygote is 24. Fertilization is the fusion of two haploid gametes and results in the creation of a diploid zygote. If two haploid gametes containing 12 chromosomes each fuse, the zygote will have 24 chromosomes (12 + 12 = 24).</span>
4 0
3 years ago
In the Galapagos Islands, Charles Darwin found many different species of finches (a type of bird) that seemed closely related. H
nlexa [21]

Answer: the beaks of the finches are adapted to the way the bird usually gets food. :) good luck!

6 0
3 years ago
Is cutting a piece of DNA with a restriction enzyme depends upon the sequence of the DNA?
Gwar [14]

Answer:yes

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • Why do scientist publish their work
    15·1 answer
  • Does nonpolar mean hydrophobic or hydrophilic
    14·1 answer
  • The sharp reduction of numbers of a population and with it the gene pool through a severe epidemic is an example of :
    7·1 answer
  • To qualify for a diagnosis of bulimia nervosa, what must be TRUE of the compensatory behaviors displayed?
    6·1 answer
  • What is the expected phenotypic ratio from a cross of heterozygotes (A1A2 x A1A2) for a phenotype that expresses incomplete domi
    11·1 answer
  • Western and Eastern cultures tend to view dreams in the same ways. TRUE OR FALSE
    8·2 answers
  • BRAINLIESTTTT ASAP!!!
    15·2 answers
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • Correct or not? <br><br>Confirmation ​
    14·1 answer
  • Describe two effects that ingesting microbeads has on aquatic organisms.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!