1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Radda [10]
3 years ago
15

A. True

Biology
1 answer:
Makovka662 [10]3 years ago
8 0
The answer is A.) TRUE
You might be interested in
Which is true of genes? plz help asap
REY [17]
The answer is b because genes can control sn organisms traits
8 0
3 years ago
The _____ is the process that describes the formation, breakdown, and reformation of Earth's rock and mineral materials.
salantis [7]
The answer is C(rock cycle)
5 0
3 years ago
For the food chain GRASS --
yarga [219]

Answer:

hi bro mark me ad a brainlist

Explanation:

snake is the right answer

7 0
3 years ago
How does soil pollution affect the productivity of soil?
suter [353]

Answer:

The toxic chemicals present in the soil can decrease soil fertility and therefore decrease in the soil yield. The contaminated soil is then used to produce fruits and vegetables, which lacks quality nutrients and may contain some poisonous substance to cause serious health problems in people consuming them.

4 0
2 years ago
Read 2 more answers
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following organelles is important for lipid synthesis and detoxification of the cell?
    13·1 answer
  • A client who is pregnant for the first time attends the prenatal clinic. she tells the nurse, "i'm worried about gaining too muc
    15·2 answers
  • If a cell skipped metaphase during mitosis, how might this affect the two daughter cells?
    9·1 answer
  • Which of the following items would be included as part of earth science?
    11·2 answers
  • Choose the answer that best describes the sequence of the scientific method. 3)
    7·2 answers
  • Advantages of water for renewable resource​
    15·1 answer
  • Hi i’m doing a test and I really really need help with this for forces question I’ll give you 10 points
    8·1 answer
  • How does an iron nail change after being exposed to the oxygen in the air over a long time? Question 24 options: It burns It dec
    9·1 answer
  • As compared to developing countries, developed countries have a
    13·1 answer
  • What is the difference in average speed between two cars that have traveled 150 km in five hours and the other traveled 130 km t
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!