1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stich3 [128]
4 years ago
9

What does the word denature mean

Biology
2 answers:
nexus9112 [7]4 years ago
7 0

Denature means to deprive of natural qualities. In other words, dehumanizing.

Len [333]4 years ago
3 0

to take away or alter the natural qualities of

You might be interested in
Which event leads to a diploid cell in a life cycle?
Evgesh-ka [11]

Answer:

Fertilization

Explanation:

6 0
2 years ago
Which of these does not occur in the Krebs cycle?
PilotLPTM [1.2K]

the answer you are looking for is B. Glucose is broken down into two pyruvate molecules.

this process occurs during glycolysis

5 0
3 years ago
Can muscle fatigue be attained with short repetitive contractions in a 5 minute period?
DENIUS [597]

Answer:

Muscle fatigue is a common complaint in clinical practice. In humans, muscle fatigue can be defined as exercise-induced decrease in the ability to produce force.

Explanation:

8 0
3 years ago
which system works together to provide protection for the body with the system shown in the diagram above? ​
olasank [31]
Djidndoejieheihsusheiwbssjksjsdjsvsb
7 0
3 years ago
White wheat flour is made from the tissue within the wheat kernel that nourishes the developing wheat embryo. what is this tissu
9966 [12]
The answer to your question is endosperm!
7 0
4 years ago
Other questions:
  • If a cell with 40 chromosomes undergoes mitosis, each of the ____ daughter cells will have____ chromosomes.
    10·1 answer
  • Mr. carusa has chronic hypertension. he is scheduled for a procedure in which x-rays are taken after contrast material is inject
    5·1 answer
  • Same force on two object of different masses
    15·1 answer
  • When geologists refer to the " Big Five", what are they referring to?
    8·2 answers
  • An organelle surrounded by a double membrane is the__________
    6·1 answer
  • Genevieve often feels as though she is going to fall over while walking. her doctor diagnosis a tumor in her _____.
    8·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which blood type can be given to anyone?<br><br> A : A<br> B : B<br> C : AB<br> D : O
    10·1 answer
  • EXPLAIN how plants allow all organisms on Earth to survive? (3-4 reasons required)
    7·1 answer
  • Why is distinction of crude density and ecological density necessary? and which one of these densities are greater?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!