1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
makvit [3.9K]
3 years ago
12

What is the importance of the high heat of evaporation for mammal​

Biology
1 answer:
Arte-miy333 [17]3 years ago
5 0

Answer:

Evaporation uses energy, and the energy comes from body heat. Animals with fur, such as dogs, use panting instead of sweating to lose body heat (see Figure below). Evaporation of water from the tongue and other moist surfaces of the mouth and throat uses heat and helps cool the body.

Explanation:

Best answer for you

You might be interested in
Suppose a dominant allele (N) codes for a big nose and a recessive allele (n) codes for a small nose. Imagine that an organism r
Marta_Voda [28]

A. The organism has a large nose, because it's homozygous.


6 0
3 years ago
In the diagram, what type of mutation is shown?
jeka94

Answer:

substitution - a base was changed

Explanation:

The nucleotide sequence CTT was changed to the sequence CAT. The T was substituted with an A. This changed the encoded amino acid from Glu to Val.

An insertion is where an additional base is added (e.g. if the sequence changed from CTT to CATT)

A deletion is when a base is lost (e.g. if the sequence changed from CTT to CT)

8 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Which best describes the brain stem?
zepelin [54]
The answer is C. The brain stem controls blood circulation.
4 0
3 years ago
Read 2 more answers
Which of the following is true about bases?
kompoz [17]
I think it would be A hope that helps
6 0
3 years ago
Other questions:
  • A 49dash–yeardash–old male has been stabbed in the lower right chest. police tell you that the patient got into an argument with
    9·2 answers
  • List three solutions that scientists are suggesting to solve the problems caused by monoculture farming
    12·2 answers
  • A fictional* element has 12 neutrons, and 31 protons, and 31 electrons. What is its atomic mass? Write just the number, no units
    11·1 answer
  • What are three questions that focus on the cause and effect relationship between the genetic code and gene expression, mechanism
    12·1 answer
  • 1.Transcription is the process of copying a gene to create?
    9·1 answer
  • Nitrous oxide dilutes the air a person breathes, depriving the individual of oxygen.
    12·2 answers
  • The San Andreas Fault is known for which of the following?
    6·1 answer
  • Choose...
    13·1 answer
  • What is the equation for a photosynthesis???????????????​
    9·2 answers
  • What part of the plant is the female reproductive structure that holds the stigma and the ovule?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!