1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
abruzzese [7]
2 years ago
12

Structural and functional characteristics of plant tissues

Biology
2 answers:
DENIUS [597]2 years ago
5 0

Answer They differentiate into three main tissue types: dermal, vascular, and ground tissue. Each plant organ (roots, stems, leaves) contains all three tissue types: Dermal tissue covers and protects the plant, and controls gas exchange and water absorption (in roots).

Explanation:

Brrunno [24]2 years ago
4 0

CHARACTERISTICS- it's the fundamental packaging tissue that fills the spaces between other tissues and is found most abundantly in plants. they need unspecialised/ undifferentiated cells with thin cell walls product of cellulose. they need large intercellular spaces because the cells are loosely packed.

Plant cells are formed at meristems, and so turn out to be cell types which are grouped into tissues. Plants have only three tissue types: 1) Dermal; 2) Ground; and 3) Vascular. ... plant tissue includes xylem, phloem, parenchyma, and cambium cells. Two views of the structure of the basis and root meristem

You might be interested in
Some people cannot digest milk products because they lack an enzyme to break down lactose in milk.
Nady [450]

Answer:

Lactase

Explanation:

7 0
2 years ago
What is the species number of eubacteria?
Svetllana [295]
4,000 species can be found around the world
7 0
3 years ago
It’s 7:00 at night and you haven’t eaten anything since lunch. Which part of your brain is telling you that you’re hungry?
strojnjashka [21]
The the lateral hypothalamus
6 0
2 years ago
A student is performing experiments on a particular substance. Which
koban [17]

Answer:

of what substance??

Explanation:

4 0
3 years ago
Read 2 more answers
Why is the concept of using the information in DNA to make proteins considered the central dogma of biology
serg [7]

Answer:

"The central dogma of molecular biology explains the flow of genetic information, from DNA to RNA, to make a functional product, a protein. The central dogma suggests that DNA contains the information needed to make all of our proteins, and that RNA is a messenger that carries this information to the ribosomes."

Explanation:

7 0
2 years ago
Other questions:
  • A change in one or a few nucleotides that occur at a single point in the DNA sequence
    15·1 answer
  • "in the _____________ context, patients do not know if they are going to die because the doctor and staff deliberately keep the
    10·1 answer
  • Which of the following is an example of a beneficial mutation?
    11·2 answers
  • In the 1960s the theory of plate tectonics was further developed through advancement and the study of
    12·2 answers
  • Which of the following is a nonrenewable resource A.Biomass B. natural gas C. wind D. Hydropower
    12·2 answers
  • Radar can be used to detect the location and movement of precipitation. Please select the best answer from the choices provided
    5·2 answers
  • The response of an effector is:
    8·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What distinguishes a dicots vascular stem system from a monocot?
    9·1 answer
  • Evaluate this statement. Is it correct? Pick the option that has the best argument for/against this claim.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!