1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paraphin [41]
3 years ago
14

The rhythmic, wavelike motion produced by smooth muscles in tubular visceral organs is called _______.

Biology
1 answer:
castortr0y [4]3 years ago
6 0

Answer:

Peristalsis

Explanation:

This motion is to facilitate the movement of food to the mouth to the stomach and helps food travel from the small intestine to the rectum

You might be interested in
(PLZ READ, TRANSLATE IF U HAVE TOO)
Levart [38]
The translation is:
<span>I just love the attention I get from all of you for a brief moment when writing these.</span>
6 0
3 years ago
Read 2 more answers
Which of the samples shown below are photosynthetic
Advocard [28]

Answer:

A, C and D are photosynthetic. They are green stained suggesting the presence of chloroplast and has multiple mitochondria for energy production

6 0
3 years ago
I'M GIVING YOU 100 POINTS FOR THIS AND BRAINLY. PLEASE HELP!!!!
natali 33 [55]

only about 3% because all of the other water would have to be filtered incorrect to be safe to drink so the student was incorrect in saying that there was water directly for humans to drink

3 0
3 years ago
Read 2 more answers
Such antimicrobials exhibit a range of cellular targets, the ____________ selective being the most effective against the widest
Inessa [10]

Answer:

least, most

Explanation:

Antimicrobials are substances that function by limiting the activities of microorganisms either by killing them or by inhibiting their growths.

Antimicrobials that exhibit a wide range of cellular targets are least selective of the type of cells they kill or inhibit. They are also said to have a wide spectrum of activities.

On the other hand, antimicrobials that exhibit a narrow range of cellular targets are most selective of the type of cells they kill or inhibit. They are said to have a narrow spectrum of activities.

3 0
3 years ago
What happens to the body cells if the kidney produce very little urine?
Andreas93 [3]

Explanation:

Having filtered out small essential molecules from the blood - the kidneys must reabsorb the molecules which are needed, while allowing those molecules which are not needed to pass out in the urine. Therefore, the kidneys selectively reabsorb only those molecules which the body needs back in the bloodstream.

4 0
3 years ago
Read 2 more answers
Other questions:
  • What is a naturas or human-made body of water surrounded by land
    8·1 answer
  • Do you think there is a relationship between heart rate and blood flow?
    8·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Jet streams vary in height of four to eight miles and can reach speeds of ____?
    14·1 answer
  • Trace evidence is a type of circumstantial evidence, examples of which include:
    14·1 answer
  • Pls answerrrrr guys. i need the answer. if u answer i will mark u as brainliest and follow u too
    15·1 answer
  • which of the following is a type of circulatory system open closed both a and b or none of the above
    8·1 answer
  • From the third month to term, the developing human is called a(n):
    6·1 answer
  • Please help ASAP !! <br><br> punnet squares- biology
    9·1 answer
  • There is a genetic trait called sun sneezing when sufferers from ACHOO syndrome sneeze uncontrollably when exposed to direct sun
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!