The natural resource management aims at saving the natural resource for the coming generation without depriving the demand of the present generation. There must be a sufferable way to use the natural resources because unlimited use of resources will guide to some problems.
The natural resource management also seeks at using the natural resources in its pure shape and making it available to every possible place.
<h3>What are the advantages of natural resource management?</h3>
When watched for in the right way, they can help us to reduce flooding, enhance air quality and supply materials for construction. They also provide a home for some rare and stunning wildlife and iconic landscapes we can relish and which boost the economy via tourism.
To learn more about natural resource management, refer
brainly.com/question/14665426
#SPJ9
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
Answer:
maybe
Explanation:
LOL not to be mean but you can look it up on Google
Answer/Explanation:
D
Trees improve water quality by slowing rain as it falls to the Earth, and helping it soak into the soil. ... Having a buffer of forestland by streams and riverbanks does more than just filtering the water.
