1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Salsk061 [2.6K]
3 years ago
12

What are 3 of the major agents of erosion?

Biology
1 answer:
IgorC [24]3 years ago
4 0
Wind gravity and ice wear hope this helps:D
You might be interested in
Molten lava come to the surface and cool forming the first land. true or false
Ostrovityanka [42]

Answer:

true

Explanation:

common sense

your welcome for helping :)

7 0
3 years ago
Read 2 more answers
Explain why athletes need to eat lots of complex carbohydrates during training.
Andru [333]

Answer:

The carbohydrate is one of the most important nutrients needed in the diet of an athlete, as they are important to increase their performance during physical activity and exercise.

Carbohydrate is the main source of energy needed by the brain and by our body for its proper functioning. when carbohydrates are eaten up they are broken up into small sugar unit called as glucose.

These glucose unit are stored in the muscle and liver in the form of glycogen to be used as a fuel at the time of exercise and during intense physical activity. It is known to enhance the athlete performance by delaying the fatigue and help them to compete for a longer period of time.

6 0
3 years ago
Read 2 more answers
Which of the following tags should be used to retrieve information from a
Viefleur [7K]

Answer:

<em>The correct option is A. Nucleotide sequence, human, hemoglobin</em>

Explanation:

If the segment of the DNA for the human gene is known then it will be very easy to find the gene on a database. The tags which should be used will be the nucleotide sequence, where the known sequence shall be mentioned.

Then we will choose the tag for the organism which is humans in this case. Then we will select the tag for the protein which is made by the nucleotide sequence, which is protein in this case. Hence, option A is the correct answer.

4 0
3 years ago
Identify the four postulates of natural selection. select all that apply. view available hint(s) select all that apply. individu
koban [17]
The four postulates of the natural selection include.
1. individuals possessing particular traits are have higher likelihood of surviving and reproducing.
2. different individuals in a population have different traits
3.reproductive and survival rate vary with individuals in a given population.
4. some trait differences are inheritable.  
4 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Other questions:
  • I need this asap!
    9·1 answer
  • For each statement below, indicate whether it is true or false.
    5·1 answer
  • The diagram represents part of a plant cell. Identify the location in the plant cell where carbon dioxide fixation occurs.
    8·2 answers
  • The Florida Everglades is home to many threatened and endangered species, such as the cougar. What should scientists and Florida
    15·2 answers
  • Which of the following is a feature of vitamin E?​ a. ​The vitamin functions as a hormone-like substance. b. ​The RDA is based o
    10·1 answer
  • Look at this photo showing two dogs of different
    5·1 answer
  • Cell contain hereditary information which is passed from parent cell to daughter cell during cell
    9·1 answer
  • Which of theses processes does NOT occur as part of the cell cycle in animal cells?
    12·1 answer
  • What are the 2 cells that use meiosis to replicate?
    13·1 answer
  • Write a brief explanation of the rock cycle in your own words.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!