1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nignag [31]
3 years ago
5

Why is conserving resources important?

Biology
1 answer:
Digiron [165]3 years ago
3 0
We only have 1 planet, and many of the things on this planet will not last forever at the rate we're using them. It's important to conserve recources so people in the future can have them, and so we can continue to live in the type of world, or better, that we live in today.
You might be interested in
What is the and product of mitosis!
sergejj [24]

Answer:

jkdj

Explanation: 1

5 0
3 years ago
Facts about cellulose (multiple choice)
bixtya [17]

Answer:

a maybe correct me if im wrong

6 0
3 years ago
How do new cells form in plants and animals?
frozen [14]
In both animals and plants, cells produce new cells by mitosis - but they split differently. A cleavage farrow forms in the animal cell and it splits. For the plant cell, a cell plate forms and then the cell splits.
7 0
3 years ago
13 Why should animals become
devlian [24]

Answer:

If the animals adapted to fast flowing are found in slow moving water- it could be: 1) They are temporarily dislodged & will get back to its original position or search for a suitable place. 2) If the niche is the same, slow moving water might be only a temporary phenomenon.

7 0
3 years ago
Martin buber states that "i-it" and "i-thou" represent two ways in which humans can relate to one another. what is the differenc
sergeinik [125]
The I -It relationship is a relationship of subject to object. In this type of relationship, human being perceive each other as having specific, isolated qualities and perceive themselves as part of the world which is made up of things. The relationship is stable, predictable and detached. 
 The I - thou is a relationship of subject to subject. In this type of relationship human beings are aware of each other as having unity of being.
The major theme of Martin Buber is that human existence may be defined by the way in which we engage in dialogue with others and with God.
3 0
4 years ago
Other questions:
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • What are organelles and what do they do?
    7·1 answer
  • Help Please!! How can tonicity affect the health of a living organism? Give one real world example!
    7·2 answers
  • Why is it important for individuals to reduce their carbon footprints?
    15·2 answers
  • How can gardeners and farmers add nutrients to soil? (Select all that apply.)
    12·1 answer
  • How do the different types of mutations affect the number of amino acids that are different from the original amino acid sequenc
    11·1 answer
  • What is the main purpose of photosynthesis and cellular respiration
    7·1 answer
  • Plz plz plz help Which of the following provides evidence for past tectonic plate motions?
    10·1 answer
  • Hello! I can't find the constants and am a little confused. Could you help me please??​
    9·1 answer
  • What are the character to define prokaryotes?​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!