1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nikitich [7]
3 years ago
14

As the human population grows, what happens to our natural-resource requirements?

Biology
2 answers:
CaHeK987 [17]3 years ago
8 0
<span>As the human population grows, our natural resource requirements increases. The answer is letter A. One, the source of food is important for survival. More humans needed the right nutrition to improve bodily functions. And therefore, more lands are to be cultivated for agricultural production to suffice the needs of the society.  Two, humans need extra habitable area to live.  It does not go in cycles because the ecosystem is not balanced. Population explosion is the main cause why these natural resources slowly decreases and at the same time increases their demand.</span>
olga2289 [7]3 years ago
3 0

the answer is A. THEY INCREASE

You might be interested in
What best describes the purpose of technology
fenix001 [56]
The creative use of science to solve problems.
8 0
3 years ago
Your teacher gives you a plant that does NOT have vascular tissue. However, it has a spore-producing capsule that opens by split
WARRIOR [948]
Wait no i know what it is its the Liverwort. Yes its that.
6 0
3 years ago
When the air inside a school gets warmer (temperature increases) the molecules of air move faster. True or False?
sergejj [24]

Explanation:

yes this is in fact true

8 0
3 years ago
Read 2 more answers
The term respiration describes the exchange of gases between your blood and the air. Cellular respiration ________.
kotegsom [21]

Answer:

The term describes cellular respiration

Explanation:

Cellular respiration, also known as internal or tissue respiration can be represented by the equation:

C6H12O6 + 6H2O ---> 6H2O + 6CO2 + Energy (in form of ATP)

From the equation, glucose from the blood is oxidized by oxygen trapped from the air by the nostrils. The main purpose of cellular respiration is to generate energy required by the body for various life activities

8 0
3 years ago
Which of the following describes a population
laiz [17]

Answer:

Explanation:

Thus, the first equation to consider simply shows that the change in the number of individuals in a population in a given time interval is the population growth rate

4 0
3 years ago
Other questions:
  • In the food chain, the grasshopper would be classified as a?
    15·2 answers
  • It is important to have a source of good drinking water. Water found underground is referred to as
    12·1 answer
  • 20. How did HeLa cells make it possible to diagnose trisomies like Down syndrome?
    14·1 answer
  • What is the evolutionary importance of plants. Not a specific plant, just plants in general.
    10·1 answer
  • Which of these is a protein?<br> A. table sugar<br> B. sunflower oil<br> C. collagen
    13·2 answers
  • Which property of water help it to move from the roots of a plant, up the stem, and to the leaves
    8·1 answer
  • The lipopolysaccharides are found in the Choose one: A. inner membrane. B. periplasm. C. cytoplasm. D. outer membrane.
    6·1 answer
  • 074<br>Discuss the trends of taxonomy<br>today?​
    15·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • If you use the letter E for this gene. what is the genotype of the offspring if the parents were EE x ee
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!