1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Archy [21]
2 years ago
11

Compare the potiential energy stored in lipids proteins and carbohydrates​

Biology
1 answer:
yarga [219]2 years ago
7 0

Answer:

The amount of lipids stored as an energy reserve far exceeds the energy stored as glycogen since the human body is simply not capable of storing as much glycogen compared to lipids. Lipids yield 9 kcal of energy per gram while carbohydrates and proteins yield only 4 kcal of energy per gram.

You might be interested in
Which of the following statements about chromosomes is true?
SashulF [63]

Answer: different organisms have different chromosome numbers

Explanation: eukaryote cells have more than one chromosome

chromosomes are present in most cells all the time (not in erythrocytes), but cannot be visualised except during telophase of mitosis or meisosis

bacterial cells don’t have a nucleus

7 0
2 years ago
Using your knowledge of meiosis and mitosis,
blondinia [14]

Answer:

just see explainxgzxfdtitithhsfai

4 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Mee help right right now please
kipiarov [429]

Answer:

1) B - protein channel

2) D - to assist in the movement of substances across the membrane by facilitated diffusion or active transport

Explanation:

1) B is the answer because the proteins would travel through the protein channel to enter or leave the cell.

2) D is the answer because the channel allows protein molecules to pass through a selectively permeable cell membrane through active transport and facilitated diffusion.

Hope this helps!

6 0
2 years ago
Read 2 more answers
Read "Charting the Pathways of Evolution" and answer the questions that follow.Explain the main idea of the article in detail.
IrinaVladis [17]

Answer:

The core concept is the sentence. The start. It's the biggest thought on the subject. There was a mistake. The author will find the principal idea in a paragraph in various ways. The principal concept is normally a phrase, and usually is the first phrase.

Explanation: detailed enough i hope

6 0
3 years ago
Read 2 more answers
Other questions:
  • How does the structure of a nephron directly relate to function of the kidney
    14·1 answer
  • RGY CONCEP<br> ESSENTIAL QUESTIONS<br> • How do Earth's land<br> biomes differ?
    15·1 answer
  • Which of the following is a common feature among the four inner planets
    9·1 answer
  • Cells require glucose as a source of energy to carry out life processes. Large molecules like glucose cross the cell's plasma me
    12·1 answer
  • A crime scene team has been called in to investigate a crime. The fingerprinting expert dusts the scene with a fine powder and b
    8·2 answers
  • Human skin becomes dry during winter, making it more prone to infections than during summer. How do the sebaceous glands protect
    10·1 answer
  • Which of the following most accurately represents the various feeding relationships within an ecosystem?
    13·2 answers
  • What causes the phases of the Moon as seen from Earth?
    15·2 answers
  • After a hunt a wolf eats more than it needs at that time. the extra glucose combines to form which substance?​
    11·2 answers
  • A(n) ____ is an approximate representation or simulation of a system.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!