Every offspring does not look alike they change with the generations
Answer: Depending on the species they mightreproduce asexualy or they will adapt to have offspring.
Explanation:
Restriction enzymes<span>, also known as </span>restriction endonucleases<span>, are </span>enzymes<span> that cut a DNA molecule at a particular place. They are essential tools for recombinant DNA technology. The </span>enzyme<span> "scans" a DNA molecule, looking for a particular sequence, usually of four to six nucleotides.</span>
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
spiders are. generally ectotherms.Their internal temperature depends on external temperature transfer.They are also poikilothermic because the body temperature varies with that of the external environment.,
In animals, individual cells are grouped into tissues. e,g Blood. The tissues gives rise to organs.
A main function of most types of epithelial tissue is covering surfaces.They line major all hollow surfaces, and covering body surfaces.
Resorption id the movement of fluid from the glomerular filtrate back into the blood. Ions, glucose,and other escaped metabolites are returned to the blood stream.
In humans, goosebumps are a vestige of a mammalian adaptation to thermoregulation. This is a thermoregulatory mechanism to regulate the body temperature,Goosebumps emits heat, to turn the moisture from the skin to vapour. This evaporate to release this moisture, which cools the body.
Explanation:
