1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kow [346]
3 years ago
6

What would happen if there was no oxygen

Biology
2 answers:
Marysya12 [62]3 years ago
5 0
We can't survive and all one die ......
LUCKY_DIMON [66]3 years ago
4 0
We would all die there would be no human life at all nothing would be here just like on mars 
You might be interested in
Over the past​ half-century in the united​ states, health care spending has​ ________ and health care outcomes have​ ________.
chubhunter [2.5K]
Hi the answer is spending has increased, and health care has improved. Hope this helps. Can you name this the brainiest thanks.
4 0
3 years ago
Can someone please help with this urgently. <br><br>you don't have to explain, just answer ​
Shalnov [3]

Answer:

B. option A 2 daughter cells

C. option D metaphase

7 0
3 years ago
Read 2 more answers
The image above shows various human
Sphinxa [80]

Answer:

C

Explanation:

BECAUSE I DID THIS

3 0
3 years ago
Which of the following is true about science and technology? A. Advancements in science cannot lead to advancements in technolog
lesya692 [45]

Answer:

D

Explanation:

Science was needed to make technology and technology helps make scientific advancements. Ex- looking at a blood cell through a microscope to find s cure for a virus.

Ex- someone had to build a telescope using science to see the stars.

6 0
3 years ago
Humans can hear echolocation of bats, as they try to find food in the night sky.
maw [93]

Answer: False

Explanation: This is FALSE because the bats make a high frequency  sound and we can't hear that type of sound.

3 0
3 years ago
Other questions:
  • The antibiotic rifamycin blocks synthesis of RNA from a DNA template. The most immediate effect would be to
    7·1 answer
  • QUESTION 6 What is the relationship between genes and alleles? Genes carry instructions for proteins that express traits. Allele
    13·2 answers
  • The shrinking of the Aral Sea has led to altered weather and rainfall patterns over the entire region. This is most likely cause
    7·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • The gradual change and build up of organisms in an environment
    7·1 answer
  • Please help me!<br> -temperature<br> -ocean<br> -climate
    6·2 answers
  • Which of the foldwing is the most important in determining how quickly materials can move into and out of
    14·1 answer
  • Ifyou have a punnet square with gg and GG what percentof offfspring will have green feathers?
    11·1 answer
  • Identify the cause of impure groundwater.
    14·1 answer
  • Which of the following organisms would usually compete with mice for seeds to eat in an ecosystem?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!