1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oxana [17]
3 years ago
5

Which of the following can be expected to occur as climate change continues on earth?

Biology
1 answer:
vivado [14]3 years ago
3 0

I believe the awnser is D] Increased coastal flooding.

Hopefully I helped :)

You might be interested in
Michelle and George are studying the forces and motion of a 0.8-kg low friction cart on a horizontal table. They use a spring sc
Helen [10]
Table 1: The horizontal pulling forces (F) and resulting acceleration (a) for the cart.



The cart experiences no motion when there is 0.1 N of horizontal force, so F=0 in this case. When one uses Newton's Second Law to find the acceleration caused by each force, it becomes clear that every row in the chart represents a horizontal force of approximately F=20 N. The best fit for the missing value is F=-30N.
5 0
2 years ago
What is a single celled organism that have no nucleus and can either benefit or harm the body
lidiya [134]

Answer:

Bacteria

Explanation:

Bacteria have no true nucleus because it's a prokaryote. It couldn't have been a virus because all naturally occurring viruses are pathogenic unless treated by radiation.

We have two types of bacteria,

  1. Pathogenic
  2. Commensals

Pathogenic bacteria will definitely cause disease. Commensals, however, have don't harm us and have the ability to help us.

Eg: Flora (bacteria) in our intestines produce vitamin K and most of the vitamin B complex. They also compete with the pathogenic bacteria that you might've ingested and don't allow them to increase to the number that can cause disease.

4 0
3 years ago
What type of energy increase as the weight fall​
Westkost [7]

Gravitational potential energy

5 0
4 years ago
The nurse is teaching a patient about the factors that can decrease the risk for breast cancer. which foods does the nurse encou
valentinak56 [21]
Aasasasddfgggggggvvcfdfdffrtghghgggfcccddffggggfff
5 0
3 years ago
Pls help ASAP I really need help
podryga [215]

It's B

And WHY YOU GOT A SAMSUNG COMPUTER BOIII NEED THAT MAC

6 0
3 years ago
Other questions:
  • The blending of waves. Light or sound, it’s called ..
    11·2 answers
  • A certain bacterial mRNA is known to represent only one gene and to contain about
    12·1 answer
  • Which is not a particle within an atom? <br> an ion <br> an electron <br> a proton <br> a neutron
    9·2 answers
  • Place in correct order the following steps in the process of appositional growth of cartilage. a: New matrix is produced and sec
    13·1 answer
  • Discuss the role of meiosis in gametogenesis.
    14·1 answer
  • In an experiment, the factor that we measure is called the ​
    7·1 answer
  • Which of the following correctly describes the structure and function of tissue layers found in blood arteries and veins?
    7·1 answer
  • An organic compound formed is the dark reaction of photosynthesis is
    10·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • The difference between the human nervous system and the endocrine system is that
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!