1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paha777 [63]
4 years ago
15

An example of subjective information is: a. five petals b. red stem c. shrub d. beautiful leaves

Biology
1 answer:
puteri [66]4 years ago
7 0

Answer: The answer is D - Beautiful leaves.

Explanation: Subjective data is gathered from the patient telling you something that you cannot use your five senses to measure. If a patient tells you they have had diarrhea for the past two days, that is subjective, you cannot know that information any other way besides being told that is what happened.

You might be interested in
Explain the relationship between genetic change and adaptation
miskamm [114]

Answer:

Mutations can cause instant adaptations, while natural selection is the process by which adaptations occurs over a series of generations. Adaptations are changes or processes of changes by which an organism or species becomes better suited for its environment. A mutation is an alteration of the DNA sequence

Explanation:

genetic change is basically same thing as mutation

3 0
3 years ago
Grizzly bears are omnivores that can eat up to 15 percent of
SOVA2 [1]

fish and berrys yummy lol

8 0
3 years ago
Two bone cells located in the periosteum and endosteum are
katen-ka-za [31]
Obsteoblasts and osteoclasts
4 0
4 years ago
Please Help Quick!
Novosadov [1.4K]

Answer:

B

Explanation:

because according to the graph the amount of resources doesn't vary much

7 0
3 years ago
What is the relationship between genes, dna, and cells as the basic unit of structure and function in living organisms?
Likurg_2 [28]

All living things have cells with DNA that contains genes which has genetic codes for all cell structures and determines which functions cells should perform to help the organism live.

I found a quizlet with that question on it if interested!

https://quizlet.com/90545525/ap-bio-chapter-1-evolution-the-themes-of-biology-and-scientific-inquiry-flash-cards/

6 0
3 years ago
Other questions:
  • Examples of carbohydrates are?
    10·2 answers
  • How many valence electrons does a carbon atom have?
    6·2 answers
  • Study the observed data in the table that shows the effect of plant growth in soils with different pH values.
    6·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Despite differences in size and shape, at some point all cells have DNA and a
    7·1 answer
  • What did Malthus think would limit the population size?
    13·1 answer
  • Which factors lead to stratospheric ozone
    7·1 answer
  • scientists have created dogs that are twice as strong as they would be naturally, through genetic engineering of the myostatin p
    13·1 answer
  • What is a reason for peer reriew?
    14·1 answer
  • How does DNA polymerase move along each strand of DNA
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!