A. Iron-titanium oxide helps preserve the direction of magnetic fields
Answer:
C. Hot air rises and cool air sinks
Explanation:
Wind happens when hot air rises and cool air sinks. This is a type of heat transmission called convection.
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Using computers they can measure how much rainfall is in one area or in multiple areas at a time and predict how much more rainfall is going to come later on.
Answer:
(for 1st question)
Plato's answer: This world exists because both systems are involved in the movement and support of the body, and they work together to perform these functions. Bones provide support and give the body structure. Muscles give strength, and the contraction and relaxation of muscles allow for different movements.
Explanation:
Another Answer: The muscular system is responsible for the movement of the human body. Attached to the bones of the skeletal system are about 700 named muscles that make up roughly half of a person's body weight. Each of these muscles is a discrete organ constructed of skeletal muscle tissue, blood vessels, tendons, and nerves.
