1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ahrayia [7]
3 years ago
9

Describe one structure or metabolic process that purple bacteria or cyanobacteria might have dispensed with once they became end

osymbionts in a eukaryotic cell. Describe one structure or metabolic process that purple bacteria or cyanobacteria might have dispensed with once they became endosymbionts in a eukaryotic cell. One of the most important features the bacteria might have dispensed with is the cell wall. One of the most important features the bacteria might have dispensed with is the gas vacuole. One of the most important features the bacteria might have dispensed with is the flagellum. One of the most important features the bacteria might have dispensed with is cytoplasmic membrane.
Biology
1 answer:
lara31 [8.8K]3 years ago
8 0

Answer:

The answer is <u>photosynthesis or thylakoid region of plasma membrane.</u>

Explanation:

Cyanobacteria are photosynthetic, prokaryotic organisms which are green-blue in colour. They possess a simple structure at sub-cellular level and lack a nucleus. Whereas, eukaryotic cells are more complex, multicellular and have membrane-bound organelles; this includes a nucleus that holds their DNA.

During endosymbyosis with bacteria, the eukaryotic cell develops an organelle called <em>chloroplast,</em> which is then responsible for photosynthesis.

Hence on metabolic process the bacteria might dispense would be photosynthesis, or more specifically its <em>thylakoid</em> region (infolded regions of the plasma membrane responsible for photosynthesis).

You might be interested in
Two of the structures that the nucleus depends on
hodyreva [135]

Answer:

DNA and its membrane

Explanation:

3 0
3 years ago
Read 2 more answers
A microorganism has the following characteristics: Its cells have a nucleus and cell walls, it is multicellular, and it grows in
lions [1.4K]

Answer:

It must belong to the Kingdom Fungi.

Explanation:

Fungi are the organisms that have long thread-like structures called hypha in their body. Many hyphae together form a mass called mycelium. Fungi are eukaryotes and have a well-defined nucleus in their cells. They also have cell walls that are made up of chitin. Fungi are mostly multicellular. However, yeast is the fungi that have a single cell in their body. Fungi are heterotrophs and derive their nutrition by parasitic or saprophytic mode of nutrition. Therefore, the given description tells that the microbe should be a fungus.

7 0
4 years ago
Facrtors that affect blood flow through the capillaries​
krok68 [10]

Answer:

volume of the blood

cardiac output

8 0
3 years ago
Read 2 more answers
How does the prey population benefit when individuals in this population are eaten by a predator?
kati45 [8]

Answer:

Not well

Explanation:

A large prey population means there's plenty of food for predators, the predators are more likely to survive and reproduce A large predator population means that the prey population will start to fall as individuals are killed and eaten As the prey population falls, there is less food for predators, so they too decrease in numbers

7 0
3 years ago
Why is it important for scientists to study our world
navik [9.2K]

Answer:

Scientists are important for the world because they help people understand the way the world works in very specific ways.It's a system of thought, a way in which we can organize what we know to better understand the way things work.

Explanation:

4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What's a positions statement? an example as well,it's for a lab sheet
    14·1 answer
  • An element is made up of only one kind of atom. True or False
    8·2 answers
  • The correct answer for this<br>2(4m+7)-(m-5)
    12·1 answer
  • What biological molecule could best be described as fuel and building material?
    14·1 answer
  • A client is hospitalized with posterior nasal bleeding and has a gauze pack in the posterior nasal cavity. the nurse assesses th
    12·1 answer
  • Genetic variation leads to genetic diversity in populations and is the raw material for evolution. Biological systems have multi
    7·1 answer
  • Why's it possible for many different species to live together in one ecosystem?<br>  
    7·2 answers
  • Help?!!!!!!!!????!????
    10·1 answer
  • BIO AND SCIENCE EXPERTS PLS HELP OR ANYBODY I JUST NEED HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!pLSSSSS
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!