1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fomenos
4 years ago
15

How many Egg chromosome do cats,Onion,Guinea Pig,Cow,Chicken have?

Biology
1 answer:
Katen [24]4 years ago
5 0
Cat have about 38 to 40. Onion have 16. Guinea pig - about 30. Cow have 60. Chicken have 78.
You might be interested in
Which element is an example of a metalloid?<br> A) gold <br> B) helium <br> C) iron <br> D) silicon
snow_lady [41]
The answer would be D). Silicon
4 0
3 years ago
Read 2 more answers
Which kind of organisms use photosynthesis?
Daniel [21]
Plants use photosynthesis
6 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
The structure (or shape) of a finch's beak can help you infer what kind of food
7nadin3 [17]

Answer:

c

Explanation:

because if you look at Darwin's change of evolution finches like these can break walnuts and pick at it because they have strong beaks

8 0
3 years ago
What would BEST account for the lack of population in the southwestern portion of Africa?
PIT_PIT [208]

Answer:

food

Explanation:

yummy lol

6 0
3 years ago
Read 2 more answers
Other questions:
  • Janice was researching combustion. During her research, she came across two different hypotheses—proposed at different times in
    12·1 answer
  • Which is the immediate result of stopping the glycolysis process?
    14·1 answer
  • Most common energy source in cellular resperation
    13·1 answer
  • What is Teddy's organization trying to accomplish?
    9·1 answer
  • If the interference value is 1, then what is the probability of recombination between genes A and B if: 1.There is a recombinati
    5·1 answer
  • Please answer thank u!
    5·1 answer
  • Which term is described as body systems working together to regulate the internal environment?
    10·1 answer
  • Thế giới sinh vật được phân chia thành những nhóm gì
    9·1 answer
  • How can multiple pollinators share the same habitat if they all need pollen?.
    11·1 answer
  • 8. A soft-drink bottle resoNtes as air is blown across its top. What happens to the resoNnce frequency as the level of fluid in
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!