1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Crank
3 years ago
7

Read the following scenario, and then answer the question,

Biology
2 answers:
Ad libitum [116K]3 years ago
8 0

Answer:

The correct answer is - Network System Administrator

Explanation:

Network System Administrators are professionals who are accountable for all day to day work related to the network and the internet. They help in organizing and fixing the network-related system such as LAN or local area networks, network segments, WANs, internets, and other issues related to network and communications by solving any problems that may occur with them.

Lianna experienced an internet and network issue in her system while other coworkers can access the company webpage, it is issue related to network and internet so she should contact a Network System Administrator.

eduard3 years ago
8 0

Answer:

B

Explanation:

Network System Administrator

New Edgenuity New Hampstead HS

You might be interested in
A point mutation that results in the substitution of one amino acid for another within a protein is a ______.
irga5000 [103]
<span>A point mutation that results in the substitution of one amino acid for another within a protein is a missense mutation. 
</span>This type of mutation<span> is a change in one DNA base pair that results in the substitution of one amino acid for another in the protein made by a </span>gene<span>. </span>
5 0
3 years ago
The role of enzymes in photosynthesis is
r-ruslan [8.4K]
Enzymes break up the electrons of water to yield oxygen and hydrogen gas
8 0
3 years ago
Which statement describes the role of a mitochondrion in providing a body with energy?
ratelena [41]

Answer:

It stores glucose that is taken from food so that respiration can happen later.

6 0
3 years ago
Kim is pushing a box on a flat surface. The box is moving. Which type of force is Kim using to move the box?
Sergeeva-Olga [200]
Horizontal Force
*not sure tho*
5 0
3 years ago
Read 2 more answers
Someone help me please thank you lol!
Advocard [28]
The answer is D.

hhhhhhhhhhhh
4 0
3 years ago
Other questions:
  • 1. Describe how radio telescopes are used to explore space.
    10·2 answers
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • The piracy of music and movies is often evident on file-sharing services that use the _________ protocol./11252180/4869941c?utm_
    7·1 answer
  • Color blindedness is a sex-linked trait. If we could see the pedigree chart for several more generations of the family illustrat
    9·2 answers
  • Sarah and Sally both have freckles. So does their mother. Which answer best explains how the girls inherited the trait of freckl
    12·1 answer
  • ASAP ⚠️
    8·1 answer
  • What hormone stimulates the egg to mature and the secretion of estrogen?
    6·2 answers
  • When one atoms electron is given up to another atom both atoms become what?
    6·1 answer
  • Explain what neutralization is, making sure you use the words ACID and ALKALI.
    13·1 answer
  • Explain how sexual reproduction produces variation.​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!