1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
likoan [24]
3 years ago
11

Based on the graph, an accurate prediction of the average sodium concentration at 210 minutes for athletes who drank the sports

drink would be expressed numerically as BLANKK mmol/L.
Biology
1 answer:
Vlad [161]3 years ago
4 0
Based on the graph, an accurate prediction of the average sodium concentration at 210 minutes for athletes who drank the sports drink would be expressed numerically as 140mmol/<span>L (It could be any number in the interval between 135 and 145mmol/L).
</span>
Sodium is an alkali metal, It is located in the extra-cellular cation (90% extra-cellular) there are very few in the cell. (its normal value is between 135 and 145mmol/L in the blood)
A sports drink is a drink which helps athletes replace water, electrolytes, and energy lost during sports. So in the graph, it is logical to see that the athlete restore his sodium level after drinking.
You might be interested in
 Which one of the following criteria is necessary for natural selection to occur? 
Readme [11.4K]
D. A struggle for existence is apparent.

If a struggle for existence is apparent, natural selection occurs because all of the weak/unfit/unadapted ones die.
7 0
3 years ago
Read 2 more answers
Transgenic organisms can express the foreign genes because all organisms are based on the same ____
jeyben [28]
Your answer is A) Recombinant DNA. I just took this quiz. Thanks
7 0
3 years ago
"A technician is reading the plates from a sputum culture. On the sheep blood agar (SBA), she sees flat spreading colonies with
sleet_krkn [62]

Answer:

P. aeruginosa

Explanation:

<em>P. aeruginosa</em> is a gram-negative bacteria that belongs to the family Pseudomonadaceae.

From the given question the following points lead us to conclude that the colony that will be growing would be of P. aeruginosa :

1. Flat spreading colonies with a metallic sheen on SBA - <em>P. aeruginosa</em> is known to produce smooth colonies with flat edges.

2. Fluorescent green color in the media with clear colonies on cetrimide agar - <em>P. aeruginosa</em> is known to produce pyoverdin which is a fluorescent pigment under low iron conditions.

3. Medium clear colonies that have a "fruity or grape-like odor" on MacConkey Agar - <em>P. aeruginosa</em> has a sweet fruity odor which is its characteristic odor because of the production of trimethylamine.

Thus, from all these characteristics one can conclude that the organism in the culture is <em>P. aeruginosa. </em>

6 0
2 years ago
Which terms below are associated with communication between neurons?
mixas84 [53]

Answer:

The correct answer is synapse, electrical signals, neurotransmitters.

Explanation:

Neuron communicates with other neurons via action potentials and chemical neurotransmitters through the synapse.

Two neurons form a junction that is termed as a synapse, there an action potential that results in neuron A to release a neurotransmitter (chemical).

Synapses are thought of as the site of converting an electrical signal into a neurotransmitter release which is a chemical signal.

Thus, the correct answer is synapse, electrical signals, neurotransmitters.

3 0
3 years ago
Analyze the result of a cross between two organisms that are both heterozygous for two different genes (AaBb) use a Punnett squa
krok68 [10]
(1) All the genotypes are as follows: AABB, AaBB, AABb, AaBb, aaBB, aaBb, AAbb, Aabb, aabb.

(2) Assuming that Aa is dominant and Bb is recessive, there will be 9 phenotypes with both A and B allele dominant (i.e. AaBb, AABb); there will be 3 phenotypes with just the A allele dominant (i.e. Aabb, AAbb); there will be 3 phenotypes with just the B allele dominant (i.e. aaBb, aaBB); and there will be 1 phenotype with both alleles recessive (i.e. aabb). The phenotypic ratio in this case is 9:3:3:1.

(3) The probability of producing an offspring with the aabb genotype is 1/16 or 6%.

4 0
3 years ago
Other questions:
  • Give an overview of the process depicted in the diagram
    6·1 answer
  • Which structure would a unicellular organisms most likely have to move around?
    7·1 answer
  • ____ feedback is when the body reacts in the same direction as a stimulus.
    9·2 answers
  • The word which means to cut into two parts is a.dichotomy b.wedge c.binomial
    7·1 answer
  • Is it possible today for a eukaryotic cell to live
    13·1 answer
  • What is a reasonable action that provides safer water for communities?
    11·1 answer
  • Properties of life include the use of blank to power an organisms activities
    13·1 answer
  • A high level of circulating calcium along with a loss of bone density might be symptomatic of:
    7·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Based on the graph, the half-life of this radioactive isotope is ​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!