1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pickupchik [31]
3 years ago
12

When NaOH is added to water, the hydroxide concentration increases . What can you conclude about NaOH

Biology
2 answers:
Ivanshal [37]3 years ago
8 0

Answer:

When sodium hydroxide (NaOH) is added to water (H2O), heat will be released.

Explanation:

NaOH+H2O= Na+ and OH- ions.

Sodium hydroxide is a base and can disassociate in water.

The heat released is due to the OH- ions stability. Is the result of the chemical species being brought to a lower energy state. Also as it is a very strong phenomenon, it can be used as a moisture absorber.

I hope it helps!

vlada-n [284]3 years ago
3 0
1. NaOH dissociates in water.
2. NaOH is a base.

That's what I get from that. NaOH must dissociate in water to raise the concentration of anything, and it must be basic, otherwise it would raise the hydronium concentration or nothing at all.
You might be interested in
PLEASE HELP
sineoko [7]

Answer:

The bacterial cell is a prokaryote and the fungal cell is a eukaryote.

Explanation:

Prokaryotes do not have membrane-bound organelles where eukaryotic cells do. The nucleus of the fungal cell is a give away that the fungal cell is a eukaryote. The lack of a nucleus in the bacterial cell means that it must be a prokaryote.

4 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
Idk if i asked it in the right catagory
Anon25 [30]
Light, oxygen, gravity. idk about gravity, but i put it in there for cause
6 0
3 years ago
What sense organs are located on the head and in the mouth of a pig?
Zinaida [17]
The nose and toung. i hope i helped
7 0
3 years ago
Living organisms share certain characteristics. Which of the following are characteristics of living organisms?
pantera1 [17]

Answer: Living things take in materials from their surroundings that they use for growth or to provide energy.

Nutrition

Respiration

Movement

Excretion

Growth

Reproduction

4 0
3 years ago
Other questions:
  • Collision of which two types of plates create the deepest earthquake Ocean-continental or ocean-ocean
    13·1 answer
  • Identify whether this describes heat or temperature.<br> Unit of measurement: Celsius
    12·2 answers
  • Is the current generation more wasteful than our ancestors?
    13·1 answer
  • Is sharpening a pencil a physical or chemical change?
    5·2 answers
  • Individual "A" produces 10 offspring, 8 of whom survive to adulthood. Individual "B" (a member of the same population) produces
    15·2 answers
  • Why are pollen grains useful when studying the climate history of a region?
    10·2 answers
  • A mutation is any mistake or change in the
    11·1 answer
  • What do both the theory of evolution and the cell theory have in common as scientific theories? (2 points) Both have strong scie
    6·1 answer
  • .
    10·1 answer
  • intersection of epigenetic and metabolic regulation of histone modifications in acute myeloid leukemia
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!