Answer:
large central vacuole
Explanation:
mature plant cell contains large vacuoles while a animal cell has small vacuoles
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Macrophages
Explanation:
Macrophages can be defined as a phagocytic leukocyte that can engulf a foreign bacterium.
They are cells found in the immune system as mobile white blood cells that are usually develop in response to a dead or damaged cells and even in cases of an infection.
The changes it made in forensic science by making it easier to prove if someone did or didn't do something and helps you identify someone if you cant figure out who it is
<span>Producers, like this plant, take in oxygen and release carbon dioxide during respiration, just like animals and other living things.
</span><span>Autotrophs obtain energy by the process of photosynthesis. Any living organism need energy to survive and autotrophs are no different.
</span>Producers uses the sunlight, water and CO2 to produce glucose and process it into energy.
