1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ICE Princess25 [194]
3 years ago
10

worms brake down dead plants in the soil to release nutrients. Which property of nutrients shows that they are matter

Biology
1 answer:
Y_Kistochka [10]3 years ago
6 0
Decomposition- the break down of dead organisms.
You might be interested in
The largest population that a given ecosystem can support at any time is the
san4es73 [151]
It can support the carrying capacity
5 0
4 years ago
Why is biomimicry important for animals? Give an example of biomimicry.​
Anni [7]

Answer:

Biomimicry is important for animals for survival, as looking like a known dangerous animal can lower its chances for being attacked. An example is the monarch butterfly, and its mimicked viceroy butterfly, having nearly identical wings.

Explanation:

4 0
3 years ago
A virus requires a host cell in order to?
Ad libitum [116K]
Infect to reproduce
Hope it helps you
6 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which of the following joints are diarthrosis joints? Check all of the boxes that apply. shoulder joint joints in the ankle join
Ksivusya [100]

Answer:

shoulder joints

joints in ankles

Explanation:

edgu2020

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which one of the following characteristics is not used to classify agiosperms?
    7·1 answer
  • The thermostat in a house regulates heat. When the air in a room reaches a predetermined temperature, the thermostat turns off t
    10·2 answers
  • (Giving brainliest!!)
    8·1 answer
  • The first amphibians evolved about 400,000 years ago.<br> True or False?
    6·1 answer
  • When it is sunny at the North Pole, it is dark at the South Pole. True or false
    9·2 answers
  • 2. mRNA is transcribed from molecule of
    11·2 answers
  • Which organism is the Least related to humans? Explain
    5·1 answer
  • Can anyone solve this
    6·1 answer
  • Explain your observations. What did you observe? Submit your data chart here.
    14·1 answer
  • A brown-eyed man with a blue-eyed mother marries a brown-eyed woman with a blue-eyed father. What is the probability that their
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!