1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kolezko [41]
3 years ago
13

The bones in the wings of a bat are the same as the bones found in the front paws of a raccoon. Their function is very different

. This means that there is evidence of what
Biology
1 answer:
IRINA_888 [86]3 years ago
4 0

Answer: the answer is that they is the same but they different

Explanation:

It can also mean that even if you have the same bone structure you can be different to something else but they still the same #BLM✊

You might be interested in
The "calico" pattern of coat coloration in female cats is a result of:__________
elixir [45]

Answer:

b. x chromosome inactivation

Explanation:

As you know, female cats have an x chromosome inherited from their mother and an x chromosome inherited from their father. After these two chromosomes are inherited and determine the sex of the cat, one of them will be disabled at some point in fetal development. Inside the X chromosome is the gene that determines the coat color of cats, when one of the two x chromosomes is deactivated, the other x chromosome will have all of its cells activated. In this case, if the activated chromosome is the one that has genes for the "cheetah" pattern of the coat color, all the descendants of this female cat also have the same coat.

3 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Tell in your own words:<br><br> Why is it called a Solar System?
nikklg [1K]
It’s called a solar system because solar means “relating to or determined by the sun” and system means “a set of things working together as parts of a mechanism or an interconnecting network” and the solar system is a whole bunch of planets and other things that are related to the sun and working together.
6 0
3 years ago
What would most likely occur over time if new technologies gave us information that challenged what scientists currently underst
tresset_1 [31]
The last choice seems most correct 
5 0
3 years ago
There are three ways that natural selection can chnage a population. list all three of them AND then describe atleast 2 of them.
Gre4nikov [31]

Answer:

Four conditions are needed for natural selection to occur: reproduction, heredity, variation in fitness or organisms, variation in individual characters among members of the population. If they are met, natural selection automatically results.

Explanation:

Evolution, in genetic terms, involves a change in the frequency of alleles in a population over time. What are the sources of genetic variation? Three sources of genetic variation are mutation, genetic recombination during sexual reproduction and lateral gene transfer.

6 0
3 years ago
Other questions:
  • Which statement regarding the overall pentose phosphate pathway is false? It is a mitochondrial pathway. It allows interconversi
    11·1 answer
  • A nurse is preparing to administer amoxicillin (amoxil) 25 mg/kg/day po divided in equal doses every 8 hr to a preschooler who w
    10·1 answer
  • Which plants has adaptations similar to those of a cactus
    5·2 answers
  • Both Tim and Carolyn have a widows peak but micheal has a straight hair line. What are Tim and Carolyn's genotypes?
    15·1 answer
  • Can someone please answer the question I have my finger on
    9·1 answer
  • A 5-year-old boy needs an im injection. the least painful and most effective injection site would be the
    13·1 answer
  • Yeah Why is global warming a<br> significant environmental<br> stressor
    15·1 answer
  • Lichens, like the one shown in the picture below, are usually combinations of algae and fungi that have a beneficial “mutualisti
    9·1 answer
  • Carbon dioxide enters the leaves through the process of
    11·1 answer
  • What does the following formula represent?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!