1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vitfil [10]
3 years ago
8

What are the formulas for each of the following: speed, distance, time?

Biology
1 answer:
OlgaM077 [116]3 years ago
5 0
Speed=distance/time
Distance=speed x time
Time=distance/speed
If you need anymore help message me!

You might be interested in
Mengapakah tabung didih dibalut dengan kertas hitam?​
leva [86]

Answer:

supaya tak meletup

Explanation:

sebab hitam dapat menghalang cahaya matahari daripada kena ke tabung didih agar tidak terlebih panas dan menyebabkan letupan

4 0
3 years ago
What are the parts of humen digestive system?​
sergejj [24]

Answer:

There are 11 main parts of the digestive system including: Teeth, tongue, lips, salivary glands, esophagus, liver, pancreas, large intestine, stomath, small intestine, mouth. Other parts include epiglottis, pharynx, gallbladder, appendix, rectum, along with  the diaphram, and finally, your anus (butt). I beleive you wont need any more than that.. and might actually only have to use the first 11 but.. just to make sure.

3 0
3 years ago
An ecological pyramid is a model which depicts number of organisms biomass and productivity at each trophic level. which of the
lozanna [386]
B. herbivore, because bottom level organisms are always green, producers, autotrophic and do photosynthesis
6 0
3 years ago
To offset high levels of carbon dioxide which of the following is the most viable option?
Doss [256]
B. Is the most reasonable
5 0
3 years ago
Important evidence used to support the theory of continental drift includes:
Morgarella [4.7K]

Many aquatic dinosaurs that lived in the ocean were found as fossils next to the borders of connected countries and states so this proves that the dinosaurs didn't growl legs and walk away(:D i had to)bur instead the continents and plates moved and connected to each other and that the mountains that were formed were made by the continental plates shifting together and pushing one up really high.

Hope this helps my dude and could i please get brainliest

:D


5 0
4 years ago
Other questions:
  • Eukaryotic cells reproduce asexually through the process of ________? what
    7·2 answers
  • Help please help me
    6·1 answer
  • "secretion of glucagon from the pancreas results in​ ________, which causes​ a(n) ______"__ in blood glucose levels.
    8·1 answer
  • There is an organism halfway up a branch in a branching diagram and a different organism at the tip of the branch what can you i
    10·1 answer
  • A client has been experiencing lower GI difficulties that have increased in severity, and the gastroenterologist is concerned th
    6·1 answer
  • Help ff f f ff f f f
    14·1 answer
  • transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
    7·1 answer
  • Marianne is comparing two animals: a fruit fly and a fruit bat. She asks, "Do a fruit fly and a fruit bat share a common ancesto
    12·1 answer
  • 5/28 LC-1 Evolution
    5·1 answer
  • What major structures are located within the mediastinum on a fetal pig
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!