Answer:
B. Cellulose
Explanation:
Polysaccharide are substances that contains many units of monomers called MONOSACCHARIDE. They are carbohydrate molecules consisting of very long chains of monosaccharides like glucose, galactose etc.
An example of molecule that forms from strong chains of polysaccharides is CELLULOSE, which consists of long chains of glucose units linked together by B-1,4-glycosidic bonds. Cellulose is the most abundant polysaccharide on Earth found in plant cell walls.
Answer:
<h3>The odontoid process</h3>
It exhibits a slight construction or neck, where it joins the main body of the vertebra...
<h3>Hope you like it please mark me as a brainliest
</h3>
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
The shape of the beak can tell you the function of that particular type of beak, and then the habitat in which the bird lives. For example, a bird with a long, slender beak most likely gets its food from hard to reach crevices in the ground or trees, and a bird with a short, thick beak most likely gets its food from either cracking items open or killing prey, because the shortness of the beak shows that it does not need to reach small places.
The answer is b just answerd this question in class<span />
