Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:
The rupturing of the seed coat may be included by heat from fire enabling water to enter the seed and start the process of germination
Explanation:
I hope It will help you
The role of chromosomes in cell division is to ensure the DNA is accurately replicated.
The mass of 3.41×10²⁴molecules of propylamine is 33.45 gms.
<h3>What is avogador's no. ?</h3>
Avogadro's number, the number of units in one mole of any substance (defined as its molecular weight in grams), is equal to 6.02214076 × 10²³.
<h3>How to determine the molar mass of compound ? </h3>
To this problem we first need to calculate the molar mass of the given compound. as follows:
3×12+1×9+1×14 = 59
In the next step, we simply apply the formula to calculate the mass of the compound. it is
No. of molecules ÷ Avogadro's no. × molar mass of the compound
3.41 x 10²⁴÷6.02×10²³×54= 33.43gms
Hence, the mass of 3.41×10²⁴molecules of propylamine is 33.45 gms.
Learn more about Avogadro's no. here: brainly.com/question/1581342
#SPJ1
Answer:
probability of the child having attached earlobes since it is recessive i.e (yy)
=1/4
=0.25 × 100%
=25%
Explanation:
If two heterozygous individuals have a child
i.e let the heterozygous individuals be = Xy
if both traits crosses together; their F₁ offspring will be; (XX, Xy, Xy, yy)
Xy × Xy
X y
X XX Xy
y Xy yy
probability of the child having attached earlobes since it is recessive i.e (yy)
=1/4
=0.25 × 100%
=25%