1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paraphin [41]
3 years ago
12

Which of these equations describes photosynthesis

Biology
1 answer:
wlad13 [49]3 years ago
4 0

B. 6CO2 + 6H2O ------> C6H12O6 + 6O2

I hope I helped!

You might be interested in
Which type of immunity is involved in the formation of antibodies and specific lymphocytes after exposure to an antigen?
iogann1982 [59]
B. Adaptive Immunity 
7 0
3 years ago
The average, year-after-year conditions of temperature, precipitation, winds, and cloud in an area are known as _____.
Verdich [7]

Answer:

The average, year-after-year conditions of temperature, precipitation, winds, and cloud in an areas are known as its climate.

Hope this helps!! :)

3 0
3 years ago
The karyotype indicates a problem with chromosome 18. What is the problem and what is the BEST explanation for why it occurred?
allochka39001 [22]

Answer:

C) extra chromosome; nondisjunction

Explanation:

3 0
3 years ago
A symbiosis in which both species benefit is
Ksenya-84 [330]
B) Commensalisms is the right answer
3 0
3 years ago
Read 2 more answers
If wolves had not been brought to the island what factors might influence the deer population size?
olasank [31]

The deer population would increase because nothing is killing them, but competition would eventually occur because they would have to start fighting against each other for resources to live.

7 0
3 years ago
Other questions:
  • How does the potential volume of the pleural sacs change during inhalation?
    12·1 answer
  • A scientific theory is an explanation that
    7·1 answer
  • Which of the following does not describe Dinoflagellates?
    11·1 answer
  • What is the function of the cell membrane in a cell?
    5·1 answer
  • During which type of cell division does each daughter cell contain half the amount of dna as did the cell just prior to cell div
    9·1 answer
  • Cuales son la caracteristicas de un cuento?<br><br> pdt:puse bilogia porque no encontre lenguaje
    7·1 answer
  • Why do you think bread turns moldy less quickly when it is kept in a refrigerator than when it is kept at room temperature
    5·1 answer
  • The equation below represents a summary of a biological process
    11·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Which is a special concern with ocean pollution?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!