1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mart [117]
3 years ago
15

Simple curiosity is not a legitimate reason to complete a scientific investigation.

Biology
1 answer:
Finger [1]3 years ago
5 0
Idk sorry man  i hope someone finds the right answer for you. good luck

You might be interested in
Define the different types of organism relationships and give examples of each
IrinaVladis [17]

Answer:

Predator prey relationship

Explanation:

I can only think of this at the moment and it is simply between predator and prey. The predator consumes the prey and this relationship has an effect on the food chain/ food web.

4 0
4 years ago
What organism belongs to the Prokaryotic domain of life and it comes in three different
Morgarella [4.7K]

Answer:

eubacteria

Explanation:

I took the quiz :)

5 0
2 years ago
What evidence can support the theory of evolution?
Verdich [7]
Evolution by natural selection is one of the best substantiated theories in the history of science, supported by evidence from a wide variety of scientific disciplines
8 0
4 years ago
​culturally, why might females need to meet higher standards of attractiveness to be considered as credible as​ males?
Elodia [21]
It may have to do with more olden stereotypes, where women were seen to be caretakers of the family, while the male went out to work and earn for them. Many jobs back then were dependent on strength, so as long as men fulfilled their role of earning money (through labor) their looks were seen as little importance. Let me elaborate. If a man could care for his family, he was seen as admirable, or at least acceptable to society. If he couldn't earn, then he was deemed worthless. So a man's honor depended on how his strength was. In this sense, looks didn't really contribute to a man's place in society. Women, on the other hand, were the face of the family. Men would show them off to friends, so if women weren't decently attractive, then it wouldn't be very good for the male. Other than housework, the woman's job is to literally sit still and look pretty; thus the reason behind corsets, bonnets, petticoats and so on. You won't see society asking men to wear such complicated things, because their main job is to work. It would be unsuitable for a blacksmith to be wearing tight suits while hammering, no? I hope this gave you some general insight.
3 0
3 years ago
List two common objects for where the natural origin is a metal and two common objects for which the natural origin is a nonmeta
larisa86 [58]
<span>Two common objects for which the natural origin is a metal are 
- G</span><span>old and Silver

</span>Two common objects for which the natural origin is a nonmetal- it conducts heat and electricity
- <span> conducts heat and electricity</span>
5 0
4 years ago
Other questions:
  • The nurse is caring for a client with a fever (38.2c). which actions should the nurse take when caring for this client
    14·1 answer
  • The sugar maltose would be digested by the enzyme sucrase. True False
    14·1 answer
  • Are the 2 daughter cells asexual or sexual reproduction
    6·1 answer
  • What is the name of the reaction that links monomer units into polymers while removing a molecule of water from the reactants
    9·1 answer
  • Can someone help me with this?
    7·1 answer
  • A group of scientists studying the DNA of two hominids concludes the hominids have a common evolutionary ancestor. Which of the
    13·1 answer
  • Match the following. 1. period during the life of a cell when it has finished mitotic division G1 phase 2. period during the lif
    14·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Can you describe when milk is converted into curd or yogurt from your understanding ?​
    9·1 answer
  • Plz help me Thankyou
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!