1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ASHA 777 [7]
3 years ago
11

What is the major function of valves in human veins

Biology
1 answer:
Olenka [21]3 years ago
3 0
To prevent blood flowing back after each heartbeat. They ensure that the blood flows only in one direction (back to the heart).         
You might be interested in
When inhaled, crystalline silica can cause scar tissue to form on what organs?
Ghella [55]
Crystalline silica is a natural compound in the earth's crust and is a basic component of sand and granite. Silicosis is an incurable disease of the lungs caused by breathing crystalline silica dust. This dust can cause scar tissue to form in the lungs.                    
3 0
3 years ago
Read 2 more answers
Why is heating a gas in acontainer dangerous?
Alika [10]
A is the answer I think hoped I helped
5 0
3 years ago
Briefly explain how the Industrial Revolution changed agriculture, both on the farm and in cities. Write your response in
taurus [48]

Answer:

he Industrial Revolution made machine-based manufacturing more common, and increased the population and average income. Instead of farming, people came to cities to work. The millions of workers moved from farms and cottage industries to cities; which caused rising population.

Explanation:

Hope this helps!

4 0
3 years ago
which classification level is broader than the kingdom level; which branch of biology is concerned with the naming and classifyi
shtirl [24]

Domain is broader than the kingdom level.

Levels of classification that are broader than phylum are regions and kingdoms. There are five kingdoms: Monrea, Protista, Fungi, Plants.

Taxanomy is the branch of biology concerned with the naming and classifying of organisms.

Protists are described as diverse organisms because they have many different characteristics. They are either heterotrophs or autotrophs. They are also eukaryotes that are not classified as plants, animals or fungi.

Animals group of organisms includes only multicellular heterotrophs.

If two species belong to the same class, they also belong to the same taxon higher up in the hierarchy. Here they belong to the same side and kingdom.

The gradual change in a species over time is called Evolution.

The levels of classification that are broader than the phylum are domains and kingdoms.

Taxonomy is the science of naming, describing and classifying all living organisms, including plants.

To know more about Taxanomy here

brainly.com/question/16458449

#SPJ4

6 0
1 year ago
What structure regulates the amount of light passing to the visual receptors of the eye?
Vanyuwa [196]

Answer:

a. iris

Explanation:

iris is actually the structure of the eye that regulates the amount of light passing to the visual receptors of the eye

4 0
3 years ago
Other questions:
  • Why do viruses reproduce
    8·2 answers
  • An experiment was designed to investigate if caffeine would raise the heartbeat of water fleas. Two groups of water fleas were u
    12·1 answer
  • You compare them to see what is different. Sample 1: ATTACAGTACTGGCA Sample 2: ATTACAATACTGGGCA
    8·1 answer
  • PLEASE BE IN THIS PROJECT!!!!Hey guys!! Im starting a PROJECT!!!! with you guys!!!! So if you want you can get a partner for thi
    11·1 answer
  • What is the article What’s the Buzz? How Bees Interrelate with Birds, Wildflowers, and Deer By John muir about
    15·1 answer
  • In this lesson you watched a movie of children rolling a ball over the surface of a spinning merry-go-round. Describe the appare
    5·1 answer
  • Muscle that dorsiflexes the foot<br> a. Tibialis anterior<br> b. Gastrocnemius
    14·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • The joint for nodding the head is what​
    6·1 answer
  • Name the ecological instrument used in measuring aquatic factors​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!