Answer:
Both plant and animal cells have a nucleus and chloroplast where protein synthesis takes place.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
Acid deposition-usually referred to simply as acid rain-actually includes two forms of pollution, wet and dry. ... In the wet type of acid deposition, these compounds combine with water vapor in the atmosphere to form highly corrosive sulfuric and nitric acids.
Explanation:
The accumulation of acids or acidic compounds on the surface of the Earth, in lakes or streams, or on objects or vegetation near the Earth's surface, as a result of their separation from the atmosphere. Acid deposition can harm the environment in a variety of ways, as by causing the acidification of lakes and streams, the leaching of minerals and other nutrients from soil, and the inhibition of nitrogen fixation and photosynthesis in plants.♦ The accumulation of acids that fall to the Earth dissolved in water is known as wet deposition. Wet deposition includes all forms of acid precipitation such as acid rain, snow, and fog.♦ The accumulation of acidic particles that settle out of the atmosphere or of acidic gases that are absorbed by plant tissues or other surfaces is known as dry deposition.
Answer:
There have been 15 Presidents of the Philippines from the establishment of the office on January 23, 1899, in the Malolos Republic. President Emilio Aguinaldo is the inaugural holder of the office and held the position until March 23, 1901, when he was captured by the Americans during the Philippine-American War.
Explanation:
hope this helps in some way
The answer to this one is Photosynthesis <span />
