1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LenaWriter [7]
3 years ago
7

When you walk across a carpet, you become negatively charged. Why do you receive a shock when you touch a metal door handle? Ele

ctrons jump from you to the handle Protons jump from you to the handle Electrons jump from the handle to you Protons jump from the handle to you
Biology
2 answers:
Damm [24]3 years ago
6 0

Answer: Electrons jump from you to the handle.

Explanation: By walking on carpet, friction causes the rubber in your shoes to pick up electrons and then when you touch a metal doorknob you will feel a shock as the <u>electrons jump from your body into the doorknob.</u>

nikdorinn [45]3 years ago
4 0

Answer: Electrons from the door handle jump onto you.

→ Remember, only electrons can be shared, so there is no way protons nor neutrons could "jump" onto you.


Why exactly does this happen?

When you walk through the carpet, you get charged, because of the friction  caused by your shoes while walking. So, when you get charged, the electrons on the door handle interact with you.



Hope it helped,


BioTeacher101

You might be interested in
What is the name of the membrane surrounding the brain? What is the<br> function of this membrane?
wlad13 [49]

Answer and explanation:

The meninges

There are actually 3 parts—dura mater, arachnoid, and pia mater.

The brain is soft and mushy, and without structural support it would not be able to maintain its normal shape. In fact, a brain taken out of the head and not properly suspended (e.g., in saline solution) can tear simply due to the effects of gravity. While the bone of the skull and spine provide most of the safeguarding and structural support for the central nervous system (CNS), alone it isn't quite enough to fully protect the CNS. The meninges help to anchor the CNS in place to keep, for example, the brain from moving around within the skull. They also contain cerebrospinal fluid (CSF), which acts as a cushion for the brain and provides a solution in which the brain is suspended, allowing it to preserve its shape.

The outermost layer of the meninges is the dura mater, which literally means "hard mother." The dura is thick and tough; one side of it attaches to the skull and the other adheres to the next meningeal layer, the arachnoid mater. The dura provides the brain and spinal cord with an extra protective layer, helps to keep the CNS from being jostled around by fastening it to the skull or vertebral column, and supplies a complex system of veinous drainage through which blood can leave the brain.

The arachnoid gets its name because it has the consistency and appearance of a spider web. It is much less substantial than the dura, and stretches like a cobweb between the dura and pia mater. By connecting the pia to the dura, the arachnoid helps to keep the brain in place in the skull. Between the arachnoid and the pia there is also an area known as the subarachnoid space, which is filled with CSF. The arachnoid serves as an additional barrier to isolate the CNS from the rest of the body, acting in a manner similar to the blood-brain barrier by keeping fluids, toxins, etc. out of the brain.

6 0
3 years ago
A student studies a plant specimen. The student notices that the plant has seeds that are enclosed by a fruit. Which term can th
d1i1m1o1n [39]
The answer is angiosperm :)
8 0
3 years ago
Read 2 more answers
Carbon, Hydrogen, and Chlorine atoms combine chemically. What best describes this
Romashka-Z-Leto [24]

Answer:

carbon and hydrogen

Explanation:

hope it helps

7 0
3 years ago
HELP PLEASE ITS TIMED
romanna [79]

Answer:

ecosystem

Explanation:

4 0
3 years ago
Read 2 more answers
А
RideAnS [48]

Answer:

A. cell membrane

B. cytoplasm

C.ribosomes

D. DNA

8 0
3 years ago
Other questions:
  • The deepest humans have ever drilled is
    7·1 answer
  • What are thin and thick myofilaments made of?
    8·1 answer
  • The masses of all the substances either used up or formed during photosynthesis are shown below: A = 192 grams, B = 108 grams, C
    12·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What is a major difference between facilitated diffusion and active transport?
    14·2 answers
  • Which phase of cell division is considered to be the "resting state?"
    14·1 answer
  • A student sees a bee on a flower. The student wonders how the bee finds flowers. This student is displaying the scientific attit
    14·2 answers
  • Which factor increases the rate of a chemical reaction?
    13·2 answers
  • __is a technique that involves putting a healty copy if a gene
    11·1 answer
  • Is made up of prokaryotic cells,<br> Piante<br> O Ribosomes<br> Animals<br> Organelle<br> ?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!