1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olasank [31]
3 years ago
9

Ozone is a strong oxidant and virucide that can destroy the cell walls of pathogens and damage the components of DNA within cell

s. Wastewater treatment plants generate ozone by imposing a high voltage current (6-20 volts) to generate ozone from oxygen gas, and as it breaks down in the water, these components play the active role in disinfection.
Biology
1 answer:
tester [92]3 years ago
5 0

Answer:this isn't even a question

Explanation:

You might be interested in
A class of proteins that eukaryotes use to turn genes on and off by allowing transcription to ouccur or blocking it are called ?
arsen [322]
I think you're talking about histones. Histones are proteins found in eukayotic cell nuclei. Histones are what DNA wrap around so it fits inside the nucleus and helps with the formation of chromosomes.
4 0
3 years ago
Can enzymes be reused
Masja [62]

If denaturation occurs (extreme temperature change or pH changes), the enzyme will not be reusable! The structure of the enzymes are not changed. As a result of this, enzymes will be used again and again to bind onto another substrate molecule and catalyze the reaction once again.

8 0
3 years ago
The metabolic reaction that occurs in the cells of all living organisms is:
Oduvanchick [21]

Answer: The Answer is A.) Burning of fossil fuels

Explanation:

4 0
3 years ago
Read 2 more answers
Human being, grass, tiger contract the food chain​
Olin [163]

Answer:

I think it is grass_ tiger _human being

6 0
3 years ago
Read 2 more answers
UN
Lapatulllka [165]

Answer:

im not doing that sorry,

Explanation:

5 0
2 years ago
Other questions:
  • How placenta is design to provide nutrition to developing embroy
    13·1 answer
  • E. coli can grow at a higher temperature in a complex medium than in a defined medium. why
    11·1 answer
  • Carrying capacity is<br> HELPPP!!
    9·1 answer
  • List the events of the sodium potassium pump in the correct sequence, starting at the TOP.
    12·1 answer
  • When new bare land has been created or the ecosystem has been severely damaged by a fire, what is likely to occur?
    9·1 answer
  • "which systems and brain regions are most closely associated with emotion
    15·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • The baby will pass through what structure last? A.vagina, B.uterus, C.cervix, D. Fallopian Tube.
    5·2 answers
  • The diagram shows the box for an element in the periodic table.
    13·1 answer
  • Place the following in the correct order as they occur in CELL RESPIRATION.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!