1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
2 years ago
9

It is an example of the principle of the separation of powers.

Biology
1 answer:
Alja [10]2 years ago
7 0
The example of the principle of the separation of powers is all of the choices given here. So the correct answer is D, all of the above. 
You might be interested in
Trade winds blow from the horse latitudes toward the______.
Lostsunrise [7]

Answer:

the correct answer is the equator

5 0
3 years ago
The arid regions of the world rely heavily on irrigation in order to grow crops. Which of these is the biggest consequence that
liq [111]

its salinization i know because i had this question and this was correct.

7 0
3 years ago
Read 2 more answers
What kind of energy is the energy of motion
Gnom [1K]
"Mechanical Energy is the energy of motion of an object"

Hope this helps!
5 0
2 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Where do preganglionic neurons synapse with postganglionic neurons in the sympathetic nervous system?.
FinnZ [79.3K]

Preganglionic axons synapse at the sympathetic chain ganglia with a postganglionic neuron. The postganglionic neuron then leaves the sympathetic chain ganglia through a gray ramus communicans (unmyelinated axons) and reenters the spinal nerve and travels to the skin and blood vessels throughout the body.

5 0
2 years ago
Other questions:
  • What is the largest level of biological study?
    10·1 answer
  • Which type of substance cannot be separated physically
    7·2 answers
  • In addition to water, what things are necessary for an aquifer to form?
    13·1 answer
  • Help please!!! Will give brainliest!!!
    6·1 answer
  • The heart is ____________ to the lungs. The knee is ____________ to the hip. The wrist is ____________ to the hand. The mouth is
    11·1 answer
  • What is the suns hottest layer
    6·2 answers
  • What is the name of the major light absorbing pigment in green plants photosynthesis
    9·1 answer
  • Name the processes involved in protein synthesis
    6·2 answers
  • Which one of the following molecules is a byproduct of cellular respiration? A. Water B. Pyruvate C. Glucose D. Oxygen
    9·1 answer
  • What trait does cardiac and smooth muscles share?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!