1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svet-max [94.6K]
3 years ago
9

How is energy released from an ATP molecule ?

Biology
1 answer:
dusya [7]3 years ago
4 0

When one phosphate group is removed by breaking a phosphoanhydride bond in a process called hydrolysis, energy is released, and ATP is converted to adenosine diphosphate (ADP). Likewise, energy is also released when a phosphate is removed from ADP to form adenosine monophosphate (AMP)

You might be interested in
What is it called when scientists examine how well other scientist follow the scientific method?
Phoenix [80]
I think the answer you are looking for is peer review.
3 0
3 years ago
When blood glucose levels are difficult to control in Type II diabetes, some forms of insulin may be added to the treatment regi
Elanso [62]

Answer:

Newer premixed insulins are better at lowering hemoglobin A1c and postprandial glucose levels than are long-acting insulins

5 0
3 years ago
Look at the two images of cells.A, A hormone is inside a receptor. B, A hormone is inside a nucleus.Which of the following state
Reptile [31]

Answer:

A) Image A represents a peptide hormone that interacts with a receptor, and image B represents a steroid hormone that interacts with the cell's DNA.

Explanation:

7 0
2 years ago
Which is a major factor affecting population growth rate? (Site 1)
iVinArrow [24]

Answer:

resources        

Explanation:

5 0
3 years ago
Read 2 more answers
Compared with ect, rtms is ________ likely to produce seizures and ________ likely to produce memory loss.
olga nikolaevna [1]
<span>The answer would be: less; less

Repetitive Transcranial Magnetic Stimulation(</span>rTMS) and Electro Convulsion Therapy(ECT) are a treatment option for a patient with major depressions. Both of them is dangerous because it involves a stimulation of the brain and has a chance to do permanent damage afterward. rTMS is a newer method that has lower chance of side effect.
6 0
3 years ago
Other questions:
  • Consider the identical
    9·1 answer
  • Scientists are studying a group of ant colonies in the Arizona desert. Which question about the ants can be answered scientifica
    6·2 answers
  • How is science different from other branches of knowledge​
    8·2 answers
  • Which component cannot be part of this strand?
    12·2 answers
  • Which of the following is an example of osmosis? Group of answer choices The human body uses osmosis to move antibodies out of c
    14·1 answer
  • Global mixing of Earth's atmosphere occurs in Earth's____
    6·1 answer
  • True or false? Survival of fitness means those organisms that are best suited for their environments are going to live on to rep
    11·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • You have more ______ cells in your body than you have human cells.
    7·2 answers
  • What is pathogen????​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!