1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Firlakuza [10]
3 years ago
5

The term 'sexuality' is defined by the text as: A. An individual’s biological gender B. An individual’s sense of being either ma

sculine or feminine C. A person’s capacity for sexual feelings D. The repressed sexual inclinations of society as a whole
Biology
1 answer:
ra1l [238]3 years ago
7 0

Answer:

Option c

Explanation:

Sexuality is something that is not related to the biological/physical make of an individual. However, it defines the sexual thoughts, behavior and attractions/liking towards others. Everything irrespective of its type i.e physical, sexual and emotional contributes to defining the sexual attraction, behavior or linking is termed as sexuality. It defines a person and creates positive and liberating experiences. There are basically three types of sexuality – homosexuality, heterosexuality and asexuality

Hence, option C is correct

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Which enzyme is responsible for laying down the daughter nucleotides during DNA replication?
DaniilM [7]

Answer: C

Explanation: DNA polymerase is the enzyme that matches and lays down nucleotides to build the daughter DNA strand along each parent DNA strand. Now we're left with all these Okazaki fragments that are separate from each other, so they need to be joined together by the enzyme DNA ligase

8 0
2 years ago
Mining companies bring workers from different places. This increases business in the town nearest to the mine.
anygoal [31]

Answer:

I believe this is C) ecosystem impact

Explanation:

The interactions between human population dynamics and the environment have often been viewed mechanistically. This review elucidates the complexities and contextual specificities of population-environment relationships in a number of domains. It explores the ways in which demographers and other social scientists have sought to understand the relationships among a full range of population dynamics (e.g., population size, growth, density, age and sex composition, migration, urbanization, vital rates) and environmental changes. The chapter briefly reviews a number of the theories for understanding population and the environment and then proceeds to provide a state-of-the-art review of studies that have examined population dynamics and their relationship to five environmental issue areas. The review concludes by relating population-environment research to emerging work on human-environment systems.

7 0
2 years ago
Anyone know this by chance ?
weeeeeb [17]
あはたさたさたさたさたさたさたさたさつみよ
4 0
3 years ago
How could the cell membrane then be important for homeostasis
Masteriza [31]

Answer:

The cell membrane is an important factor for homeostasis to happen.

Explanation:

Because the cell membrane is a lipid bilayer that prevents that passage of water and ions. This allows cells to maintain a higher concentration of sodium ions out the outside of the cell.

5 0
3 years ago
Other questions:
  • The small pieces of rock plus plant and animal pieces are called?
    6·2 answers
  • The phases of the moon are caused by
    13·2 answers
  • B. Why is there a huge demand of professionals in the field of agriculture​
    14·1 answer
  • Temperate rainforest animals
    9·1 answer
  • 5. Which of the following is an example of active transport?
    12·2 answers
  • What is the type of cellular respiration that uses oxygen to produce large amounts of energy called?
    5·2 answers
  • What are some factors that affect how much biodiversity an area has?<br> Hurry pls :)
    13·1 answer
  • What allows some individuals to have an advantage over others of the same species
    6·1 answer
  • The coral snake is venomous, while its mimic- the scarlet king snake- is not. This is an example of? 1. Mullerian mimicry 2. Che
    11·1 answer
  • Which tides are the highest?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!