1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mafiozo [28]
3 years ago
15

Explain cancer in terms of the cell cycle

Biology
1 answer:
vichka [17]3 years ago
3 0

Answer:

hey mate this is your answer

Explanation:Cancer is unchecked cell growth. Mutations in genes can cause cancer by accelerating cell division rates or inhibiting normal controls on the system, such as cell cycle arrest or programmed cell death. As a mass of cancerous cells grows, it can develop into a tumor.

You might be interested in
Which step in cellular respiration happens first?
Ksju [112]

The answer is C, Glycolysis

4 0
4 years ago
Read 2 more answers
What is the general term for any carbohydrate monomer? glucose polysaccharide monosaccharide fructose
horrorfan [7]

Answer:

monosaccharide

Explanation:

its a monomer and also because saccharide is a sugar term

let me know if this helps (✿◡‿◡)

8 0
3 years ago
PLEASE HURRY!!! Select all answers that apply.For radiometric dating, you need to know which of the following?
Darina [25.2K]
*The rate at which radioactive decay occurs.
*How much radioactive decay has occurred.
6 0
3 years ago
Read 2 more answers
A maternal effect can cause the offspring phenotype ratio to depart from that of classic Mendelian inheritance. In a species of
Luda [366]
<h2>Maternal effect</h2>

Explanation:

In maternal effect the phenotype of the progeny is decided by the genotype of the mother

  • The female partner is one step ahead to her male partner
  • The ovum transcribes some of its nuclear genes prior to fertilization and these genes are responsible for the development of embryo that is why these genes are called maternal effect genes
  • This effect is observed in Drosophila

In the given question both male and female have brown eyes with Nn genotype,phenotype of the offspring will be decided by the genotype of mother(Nn) hence despite of having recessive genotype(nn) all the offsprings will show brown eyes

6 0
4 years ago
Which of the following can be found in both viruses and cells?
Vaselesa [24]
Something that can be found in both viruses and cells is bacteria. 
3 0
3 years ago
Other questions:
  • Cactus wren and cholla cactus. What is the advantage and disadvantage of this relationship to each organism
    12·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • What is the theory of plate tectonics? Explain this scientific theory, making sure to include the following terms in your respon
    5·1 answer
  • What does this graph tell you about the relationship between temperature and the amount of water vapor that air can hold?
    7·2 answers
  • What did you include in your response? Check all that apply. Electrons from PSII would not be transported to PSI. PSI would have
    15·2 answers
  • Which one of the following is an example of osmosis? A. Water enters a plant by passing through the root cell membranes. B. Pota
    8·1 answer
  • The graph illustrates the activity level of three common digestive enzymes, across a range of pH values. Hydrochloric acid is us
    15·1 answer
  • What do we call the area of Earth,
    8·1 answer
  • Scientists have found large groups of fossils of marine organisms on mountaintops. What does this tell scientists about the past
    5·2 answers
  • According to the Hertzsprung-Russell diagram, which two groups are most likely to contain the stars with the lowest temperatures
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!