1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dem82 [27]
3 years ago
5

What is the overall trend shown in this graph?

Biology
2 answers:
zavuch27 [327]3 years ago
4 0

The graph shows an increasing trend in glacier ice loss with advancing years. This could be hypothesized to be as a result of increased global temperatures that are melting the ice.  Melting of the ice also causes an increase in the ocean levels. This phenomenon is referred to as global warming.  

AlexFokin [52]3 years ago
3 0

Answer: Melting of the glaciers with time

Explanation: From the given graph, we can determine that the red line indicates the rise in the melting of glacier (rise in the sea level height). This melting of ice are due to the reasons such as pollution, increase in the amount of green house gases, rate of increasing incoming solar radiation, decrease in the albedo, thereby increasing the height of sea level. This is called the global warming.

According to the graph, the sea level will rise to a height of 18 meter by 2015.

You might be interested in
All of the following are functions of the sensory somatic nervous system except
disa [49]
All of the following are functions of the sensory somatic nervous system except it sends signals from the peripheral nervous system. The correct option among all the options that are given in the question is the second option. I hope that this is the answer that has actually come to your desired help.
4 0
3 years ago
How do bacteria that live in a hot spring control the fluidity of their plasma membrane?
jekas [21]

Answer:

Thermophilic bacteria adjust the fluidity of their plasma membrane by increasing the distinct fatty acids and polar carotenoid content.

Explanation:

Thermophilic bacteria adjust fluidity of their plasma membrane by increasing the following content in it;

  • Branched iso-fatty acids
  • Long-chain fatty acids
  • Saturated fatty acids
  • Polar carotenoid content

Interestingly, the thermophilic bacteria that grow above 70°C possess lipid species such as diether, tetraethers, and tetra esters.

6 0
3 years ago
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
Explain the water cycle in your own words.
Lynna [10]

Answer:

the water cycle how water evaporates from the surface of the earth, rises into the atmosphere, cools and condenses into rain or snow in clouds, and falls again to the surface as precipitation.

the series of processes by which carbon compounds are interconverted in the environment, involving the incorporation of carbon dioxide into living tissue by photosynthesis and its return to the atmosphere through respiration, the decay of dead organisms, and the burning of fossil fuels.

The nitrogen cycle is the biogeochemical cycle by which nitrogen is converted into multiple chemical forms as it circulates among atmosphere, terrestrial, and marine ecosystems. The conversion of nitrogen can be carried out through both biological and physical processes.

3 0
3 years ago
Which of the following statements about viruses is false
quester [9]
Where’s the picture?
8 0
3 years ago
Other questions:
  • Cells that have not yet become specialized
    5·1 answer
  • What is an acid?
    9·1 answer
  • What system is the anterior vena cava fetal pig?
    10·1 answer
  • MULIPLY CHOSE
    10·2 answers
  • What is the most important reason to control the conditions of an experiment?
    12·1 answer
  • What sugars are easily used by our bodies?
    13·2 answers
  • Help me PLEASEE!!! IT will mean alot
    15·2 answers
  • E or False: The use of fossil fuels has contributed to more carbon released in the
    5·2 answers
  • What Are the necessary parts of a sound source model?<br>​
    13·1 answer
  • Explain the interrelationship of photosynthesis and cellular respiration.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!