1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MaRussiya [10]
3 years ago
8

How does the principle of faunal succession assist the technique of relative dating?

Biology
1 answer:
Arte-miy333 [17]3 years ago
6 0

Answer:

It provides a defined order to the succession of organisms.

Explanation: Relative dating of rocks involves the relative or comparative determination of age with reference to past events. There are several principles involved in carrying out relative dating. Some of these principles are:1. Principle of inclusion2. Principle of inclusion 3. Principle of fossil and fauna succession The Principle of fossil and fauna succession postulates that fossil and fauna succeeds one another in a definite pattern. It is this defined order that we use to achieve relative dating of rocks. Plant and animal remains constitutes the fauna and fossils used in dating the rocks. When we find a particular fossil in a rock, we can place that rock in its appropriate geological time. We can even go further by correlating rock types using their fossil contents.

You might be interested in
What is the one function of steroids
dalvyx [7]
Afunction of steroids is to increase muscle mass to help you get an advantage on your competitors.
7 0
4 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
Tiny structures within the cell that perform a particular job are called
olya-2409 [2.1K]
Organelles are found within the cells.
4 0
4 years ago
Choisis la meilleure fin pour chaque phrase.
lara31 [8.8K]
Je ne peux pas vraiment expliquer la réponse en raison de votre question confuse, mais voici une note pour faire des questions non confuses la prochaine fois
7 0
3 years ago
The process of converting the genetic message from DNA into __________ is called transcription.
Masteriza [31]
The answer is RNA, the copy of DNA.
8 0
4 years ago
Read 2 more answers
Other questions:
  • Two ways in xylem is modified to carry out its function
    14·1 answer
  • When a research project includes the collection of biological samples, all planned future uses of the samples, identifiers, and
    13·1 answer
  • Examine the weather map. The arrows are pointing to the line with triangles. What does the line indicated by the arrows most lik
    14·2 answers
  • Approximately how far apart were north america and europe 200,000 years ago
    6·1 answer
  • why would having both polar and nonpolar properties in a protective boundary be advantageous for the cell?
    9·1 answer
  • How are<br> mosquitos infected with Wolbachia?
    7·1 answer
  • Describe how heat is generated using one renewable resource such as wind, water, or the Sun.
    14·2 answers
  • Rearrange them in the correct sequence.
    6·2 answers
  • How many megaspores and how many sperm cells are involved in a double fertilization event?.
    13·1 answer
  • PLEASE HELP ASAP (FINAL)
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!