1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
professor190 [17]
3 years ago
5

If sarah had a viral infection that affected neuron function in the ventral root of the same spinal nerve, how would the signs a

nd symptoms be different than those she has now
Biology
2 answers:
svet-max [94.6K]3 years ago
5 0

The symptoms that are caused by affected ventral roots are the following:

<span> <span>1. </span>Loss of movement in the extremities
<span> <span>2. </span>Back pain
3. Pain radiating into the buttock
4. <span><span />Pain radiating down the leg
5. <span><span />Numbness, tingling, burning of the hands or feet <span> <span>
6. </span>Fatigue
7. <span />Fever
8. <span><span />Weakness <span>

Sarah on the other hand had oral fever, she has a burning and tingling sensation of the thigh, but no numbness. </span></span></span></span></span></span></span>



Nuetrik [128]3 years ago
4 0

Answer:

Sarah will not feel pain but her ability to locomotion will be affected.

Explanation:

The question here is Why Sarah will not feel pain ?

the answer is that neurons help us in sensation of pain, burn and touch. If the major part of spinal nerve is damaged how she will feel sensation of pain.

You might be interested in
A protein in the plasma membrane that binds to specific chemicals in the cell's external environment to regulate processes withi
natali 33 [55]
These are called carrier proteins.
6 0
3 years ago
during asexual reproduction in a yeast cell ,two daughter buds are formed . what is true about the daughter buds formed in the p
kirza4 [7]

Answer:

Both daughters will have the same genetic information as the parent cell.

Explanation:

The daughter yeast cell produced during the budding is genetically similar to the mother cell as it forms as a result of mitosis but is generally smaller in size as compared to the mother cell.

8 0
3 years ago
How many miles away is the moon from earth?
Gnom [1K]
The moon is 238,900 miles away from earth
3 0
2 years ago
Read 2 more answers
What is the atomic number of an oxygen atom with 8 protons and 10 neutrons in its nucleus?
mojhsa [17]

Answer:

8

Explanation:

The atomic number is the number of protons in its nucleus.

7 0
3 years ago
Read 2 more answers
In the human body, the cardiovascular system works with the respiratory system by:
White raven [17]

Answer:

answer is true

Explanation:

4 0
3 years ago
Other questions:
  • Which of the following statements is true?
    14·2 answers
  • Pochotas in the official Disney line up ?
    11·2 answers
  • The Earth's crust is like a jigsaw puzzle as shown in the diagram. Each piece is called a .... ?
    11·1 answer
  • What are the Two groups of Archaebacteria
    13·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Lipase is an enzyme that breaks down
    14·1 answer
  • SOCIEDAD PERUANA DE DERECHO AMBIENTAL (SPDA): ¿Cómo se generaron? ¿Cómo se sostienen? ¿Qué acciones realizan?
    9·1 answer
  • Howww do i do thisss
    8·1 answer
  • An imbalance that activates these bone cells would lead to a loss of bone density.
    14·1 answer
  • Explain further the idea that indicates that all of life is related and can be divided into three major clades, often referred t
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!