The Krebs cycle occurs in the <span>matrix of mitochondria. It is one of the main processes of creating energy for the organism.</span>
It would be: Rr × Rr
Result of cross would be: 1RR, 2Rr, 1rr
So, it's genotypic ratio = 1:2:1
Phenotypic ratio = 3:1
Hope this helps!
Connected to the occipital bones
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
Active transport requires cellular energy for substances to cross the cell membrane; passive transport does not.
Explanation:
Active Transport works against the concentration gradient and therefore needs energy to make it happen
Passive transport such as Diffusion and Osmosis uses the properties of natural movement of particles which moves the molecules from areas of high concentration to areas of low concentration or down the concentration gradient and happens passively without the need for energy
