1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ludmilka [50]
3 years ago
14

Which of the following has documented extensive evidence that the delivery of medical care in inequitable and that ethnic and ra

cial minorities may receive poorer quality care than white Americans?
Health
1 answer:
denpristay [2]3 years ago
5 0

Answer:

The options for the questions is not given but I do believe institutional racism has documented extensive evidence that delivery of medical care is inequitable and that ethinical and racial minorities may receive poorer health care quality than white Americans.

Explanation:

Gary King, an insightful theoretical analyst analysis in his research of (1996:35) and argues that "explanations of racial differences in medical care and of participation rates in medical research are grounded in institutional racism and in the professional ideologies of medicine and health care systems that lead to power imbalances between minorities and medicine's elite professionals"

King identifies three phrases of research which are: (1) initial “exploratory research,” which documented the differences between blacks and whites in medical care, utilizing quantitative data; (2) “contemporary” research, which focuses on coronary artery disease (CAD) and other specific diseases, using severe methods to investigate causes of disparities in treatment; and (3) most recently, “an incisive period in which researchers attempt to combine theory, methods and policy considerations” (1996:36).

King argues that for one to understand the documented differences, one must come to understand covert(implicit) as well as overt(explicit) racism and the multiple faced dimensions of institutional racism in medical and health institutions (1996:43).

In studies over several decades, it is found that “the medical gaze” soon becomes the dominant knowledge frame through medical school, that time and efficiency are highly prized, and that students and their attendings are most caring of patients who are willing to become part of their medical story that they wish to tell and the therapeutic activities they hope to pursue

You might be interested in
What is a sign of alcohol poisoning?
Fynjy0 [20]
It's is all of the above. Just a little hint for you, when there is the option- all of the above, chances are that's the answer.
4 0
4 years ago
Read 2 more answers
What is the best safety tip on this website?
kondaur [170]

Multi tasking is a myth so dont try to use your phone while driving.

8 0
3 years ago
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
Should i join the military???
Savatey [412]

Answer:

Yes, honestly.

Explanation:

The teaching of self-discipline is key for those who feel like life seems purposeless, serve your country and make yourself proud of the work you do.

4 0
3 years ago
Ill give brainliest to whoever repsonds the fastest
Sergio039 [100]

Answer:

THANK YOU VERY MUCH

Explanation:

PICK ME AS THE BRAINLIEST

6 0
3 years ago
Read 2 more answers
Other questions:
  • If your friend is suicidal but doesn’t want you to tell anyone, what should you do?
    13·1 answer
  • You and your partner arrive at the scene where a truck has crashed into a small building, injuring eight people. you immediately
    9·1 answer
  • Sven steals Margot’s social media password and begins sending inappropriate messages to Margot’s friends, pretending to be Margo
    14·2 answers
  • Extended exposure to loud noises will the hair cells inside the cochlea.
    15·1 answer
  • What to do if u hv migraine
    7·2 answers
  • Gloves must be worn when handing
    6·2 answers
  • !!!!!!!!__________ cultures are
    6·2 answers
  • Other than an X-ray, what are two other medical imaging tools a doctor can use to
    9·1 answer
  • How many pounds equals 70 kilograms
    14·2 answers
  • How much hydrogen peroxide to induce vomiting in dogs?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!