1. homeostasis
2. negative feedback loop
3. the hypothalamus
4. the body’s optimal temperature, which is 37 degrees C, or 98.6 F
5. humans are endothermic, which means they don’t completely rely on their environment for heat, unlike ectothermic organisms such as reptiles. the diagram shows that the brain is in control of the body’s temperature, and that the body can raise its own temperature in its blood.
or something like that, hope this helped
Answer:
True
Explanation:
In inhibitory postsynaptic potentials, the opening of chlorine and potassium channels generally occurs so that chlorine enters, with a negative charge, and potassium leaves, with a positive charge. The synergistic effect of this ionic flow is the hyperpolarization of the cell, making it difficult for an action potential to occur.
Hey! here is your answer
passive refilling of the heart occurs During ventricular systole, the blood pressure
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Both transcription and DNA replication are essential and significant genetic mechanisms.
Transcription is a process where the genetic material i.e. DNA is getting converted or transcribed to RNA by an enzyme RNA polymerase.
Whereas the DNA replication is a process where, doubling or copying of DNA from original DNA (identical replica copies). Which is the basis for biological inheritance.
