Hi,
I browsed through internet about the enzymes and found that there is an exercise with a list of three enzymes and probably you want to know, which are the enzymes that came from the stomach of Mondoni-a little mammal organism.
Please see the graphs i found, they contain the pH and temperature of the enzymes. So, we need to find the enzymes of Mondoni on the basis of these pH and temperature values.
The enzymes that came from Mondoni's stomach are A and B. These enzymes performed well at low pH and this indicates that they are probably digestive enzymes and have acidic nature.
Moreover, enzyme A and B perform better in low temperature and performed worst in extreme temperature like 80 degree Celsius. Their temperature range also matches with the temperature of mammals, therefore enzyme A and B came from Mandoni.
Hope it helps! :)
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Metamorphic are formed through change underground sedimentary are formed through sediment
<span>i think it is a.Molecules move against their concentration gradient. hope it helps
</span>
